ccb-1

T28F2.5 | Calcium Channel, Beta subunit 1

ccb-1 encodes a homolog of the beta subunits of dihydropyridine sensitive L-type calcium channels that, in RNAi screens, is dispensable for viability or grossly normal morphology; a mutant allele of ccb-1 exists, but its phenotype has not yet been described.

Graphics for ccb-1

3'UTR Zoom

Locus

see this gene in GBrowse

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for ccb-1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 337 - Tier: 1 - Name: ccb-1 - Cosmid: T28F2.5 - WBGeneID: WBGene00000368 - Length: 289 - PAS: gacaaa
Cluster Coverage (%): 648 reads (41.80%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
337	ccb-1	I	-	3641671	3641958	289nt	gacaaa (-20nt)	648 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|289nt|I:3641671..3641958|PAS:gacaaa
gugccuguauauucaauuguauguuuucuugugaacaaucacugauucgaauuccuuucuugaucauuuucaauaucucu
aucuaucucuuucucucuuucuucgcaacaaauggcaucuucuucgaauugcuccgaguuuuugaacaucacacccccca
caaaaaguacgagucgguuuuuuuucuagaaacuauuuuuccuuuuuuuuuuucuuuuaugauguuuuuguauuuuauau
guauaccucuauuuuuugauuguaaucuauuaaauauuuuaauuuuca

2 ID: 336 - Tier: 1 - Name: ccb-1 - Cosmid: T28F2.5 - WBGeneID: WBGene00000368 - Length: 312 - PAS: ctttga
Cluster Coverage (%): 901 reads (58.20%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
336	ccb-1	I	-	3641648	3641958	312nt	ctttga (-6nt)	901 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|312nt|I:3641648..3641958|PAS:ctttga
gugccuguauauucaauuguauguuuucuugugaacaaucacugauucgaauuccuuucuugaucauuuucaauaucucu
aucuaucucuuucucucuuucuucgcaacaaauggcaucuucuucgaauugcuccgaguuuuugaacaucacacccccca
caaaaaguacgagucgguuuuuuuucuagaaacuauuuuuccuuuuuuuuuuucuuuuaugauguuuuuguauuuuauau
guauaccucuauuuuuugauuguaaucuauuaaauauuuuaauuuucaaauauauaauuuuuuuucuuuga

Updated miRanda Targets for ccb-1 (Murari et al., submitted)

ccb-1 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
138546	cel-miR-8192-3p	ccb-1	154	-11.68	70.59	76.47
66823	cel-miR-793	ccb-1	149	-10.84	70.00	75.00
139397	cel-miR-8195-3p	ccb-1	149	-13.13	61.11	83.33
108437	cel-miR-4923a	ccb-1	145	-10.63	100.00	100.00
138547	cel-miR-8192-3p	ccb-1	145	-10.89	100.00	100.00
43174	cel-miR-247-5p	ccb-1	143	-7.25	83.33	83.33
121001	cel-miR-5546-3p	ccb-1	143	-5.09	50.00	77.78
101462	cel-miR-4809-3p	ccb-1	140	-10.58	100.00	100.00
108438	cel-miR-4923a	ccb-1	140	-7.08	100.00	100.00

Predicted or Experimental Interactors for ccb-1 (WormBase)

ccb-1 has been predicted to interact with the following genes (data from WS200):

itr-1 Zhong W et al. (2006)
itr-1 encodes a putative inositol (1,4,5) trisphosphate receptor that affects the defecation cycle and pharyngeal pumping, and also affects ovulation in a pathway downstream of LET-23; interacts with UNC-54 in vivo, and is expressed in the adult intestine, pharynx, excretory cell, germ line, and spermatheca, with limited neuronal expression.