clec-89

C09D1.2 | C-type LECtin 89

No description available.

Graphics for clec-89

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for clec-89

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 14654 - Tier: 1 - Name: clec-89 - Cosmid: C09D1.2 - WBGeneID: WBGene00015631 - Length: 136 - PAS: AATAAA
Cluster Coverage (%): 148 reads (70.80%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
14654	clec-89	I	-	4071665	4071799	136nt	AATAAA (-19nt)	148 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|136nt|I:4071665..4071799|PAS:AATAAA
uauuucccuaauugauuuguuuaguuaauuuccuagucauugcucauucacuuucuuguuuuucccgcuguuccauucca
aucaacccaagaaucucauuucaauaccgaucucugaauaaacuguguuuucaua

2 ID: 14653 - Tier: 1 - Name: clec-89 - Cosmid: C09D1.2 - WBGeneID: WBGene00015631 - Length: 143 - PAS: AATAAA
Cluster Coverage (%): 61 reads (29.20%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
14653	clec-89	I	-	4071658	4071799	143nt	AATAAA (-26nt)	61 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|143nt|I:4071658..4071799|PAS:AATAAA
uauuucccuaauugauuuguuuaguuaauuuccuagucauugcucauucacuuucuuguuuuucccgcuguuccauucca
aucaacccaagaaucucauuucaauaccgaucucugaauaaacuguguuuucauaccuucga

Updated miRanda Targets for clec-89 (Murari et al., submitted)

clec-89 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
82706	cel-miR-1830-3p	clec-89	161	-13.78	77.78	83.33
56867	cel-miR-356a	clec-89	154	-8.42	73.68	73.68
30985	cel-miR-87-3p	clec-89	151	-13.58	75.00	81.25
148652	cel-miR-8207-3p	clec-89	151	-11.34	76.47	76.47
30108	cel-miR-86-5p	clec-89	150	-11.98	100.00	100.00
35460	cel-miR-233-3p	clec-89	150	-16.84	100.00	100.00
61768	cel-miR-785-3p	clec-89	147	-13.25	65.00	70.00
12997	cel-miR-58a-3p	clec-89	142	-11.75	88.89	88.89
137179	cel-miR-8190-5p	clec-89	140	-9.86	100.00	100.00