C23H3.5

C23H3.5 |

No description available.

Graphics for C23H3.5

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP2004 (II:60040..43880)
CEOP2004 contains 6 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for C23H3.5

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15091 - Tier: 1 - Name: C23H3.5 - Cosmid: C23H3.5 - WBGeneID: WBGene00016021 - Length: 245 - PAS: aatata
Cluster Coverage (%): 825 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15091	C23H3.5	II	+	49863	50107	245nt	aatata (-6nt)	825 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|245nt|II:49863..50107|PAS:aatata
aaggagcgauuuauuguucugcauuuacaguagcccauuuggauacaguaacccaaauaggaauuuugucuccuuacgca
cuuauuuuuuugaaauacuguauuucuuaaagguacaucacauuuuggcgcggccuugauuaucguaucuuguuugcaau
agcgaauauuuccgcaaaaagucuuaauuauacuguuauuguuauuugcugauucuucauuuaugaauuuguuguuaaaa
uaua

Updated miRanda Targets for C23H3.5 (Murari et al., submitted)

C23H3.5 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
48784	cel-miR-255-5p	C23H3.5	158	-9.48	73.68	78.95
17261	cel-miR-70-5p	C23H3.5	154	-7.12	68.00	76.00
137582	cel-miR-8191-3p	C23H3.5	152	-16.79	73.33	80.00
16293	cel-miR-66-3p	C23H3.5	150	-12.16	70.59	70.59
62563	cel-miR-787-5p	C23H3.5	148	-7.28	81.25	81.25
40355	cel-miR-245-5p	C23H3.5	147	-10.11	63.64	68.18
102616	cel-miR-4811-5p	C23H3.5	147	-10.79	68.75	81.25
14314	cel-miR-61-5p	C23H3.5	145	-17.07	56.25	81.25
129951	cel-miR-5551-5p	C23H3.5	145	-10.19	66.67	86.67
128041	cel-miR-5550-3p	C23H3.5	143	-10.07	76.92	84.62
34206	cel-miR-232-3p	C23H3.5	142	-10.50	69.23	76.92