tre-5
C23H3.7 | TREhalase 5
No description available.
Graphics for tre-5
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for tre-5
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 5491 -
Tier: 1 -
Name: tre-5 -
Cosmid: C23H3.7 -
WBGeneID: WBGene00006611 -
Length: 95 -
PAS: tataaa
Cluster Coverage (%): 97 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
5491 | tre-5 | II | - | 53002 | 53095 | 95nt | tataaa (-20nt) | 97 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|95nt|II:53002..53095|PAS:tataaa
auucgauuguuuuuauaggaauuauuucaauuguacauuuaauuuuugcaaacgggguauuacuuuucucuauauauaaa gcuuuccuauccua
Updated miRanda Targets for tre-5 (Murari et al., submitted)
tre-5 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
41652 | cel-miR-247-5p | tre-5 | 155 | -18.04 | 100.00 | 100.00 | 59604 | cel-miR-784-3p | tre-5 | 152 | -11.47 | 90.91 | 90.91 | 114885 | cel-miR-5546-3p | tre-5 | 148 | -4.50 | 52.63 | 78.95 | 16213 | cel-miR-66-3p | tre-5 | 145 | -9.96 | 100.00 | 100.00 |
Predicted or Experimental Interactors for tre-5 (WormBase)
tre-5 has been predicted to interact with the following genes (data from WS200):More on tre-5
Related Papers
There are no recent papers related to tre-5.Related tre Genes

The APAome Project is currently funded by the School of Life Sciences at Arizona State University