tre-5

C23H3.7 | TREhalase 5

No description available.

Graphics for tre-5

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for tre-5

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 5491 - Tier: 1 - Name: tre-5 - Cosmid: C23H3.7 - WBGeneID: WBGene00006611 - Length: 95 - PAS: tataaa
Cluster Coverage (%): 97 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
5491	tre-5	II	-	53002	53095	95nt	tataaa (-20nt)	97 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|95nt|II:53002..53095|PAS:tataaa
auucgauuguuuuuauaggaauuauuucaauuguacauuuaauuuuugcaaacgggguauuacuuuucucuauauauaaa
gcuuuccuauccua

Updated miRanda Targets for tre-5 (Murari et al., submitted)

tre-5 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
41652	cel-miR-247-5p	tre-5	155	-18.04	100.00	100.00
59604	cel-miR-784-3p	tre-5	152	-11.47	90.91	90.91
114885	cel-miR-5546-3p	tre-5	148	-4.50	52.63	78.95
16213	cel-miR-66-3p	tre-5	145	-9.96	100.00	100.00

Predicted or Experimental Interactors for tre-5 (WormBase)

tre-5 has been predicted to interact with the following genes (data from WS200):

ftt-2 Lee I et al. (2008)
none available
par-5 Lee I et al. (2008)
PAR-5 is a 14-3-3 protein.
srt-73 Lee I et al. (2008)
none available
trk-1 Lee I et al. (2008)
trk-1 encodes a receptor tyrosine kinase that is most closely related to the vertebrate neurotrophin receptors.