F23F1.10

F23F1.10 |

No description available.

Graphics for F23F1.10

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for F23F1.10

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17006 - Tier: 1 - Name: F23F1.10 - Cosmid: F23F1.10 - WBGeneID: WBGene00017750 - Length: 58 - PAS: aataaa
Cluster Coverage (%): 3239 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
17006	F23F1.10	II	-	41471	41527	58nt	aataaa (-21nt)	3239 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|58nt|II:41471..41527|PAS:aataaa
auaugucuauuucacuuccuuugaucucgaauuaauaauaaaucgaugcaacuggua

Updated miRanda Targets for F23F1.10 (Murari et al., submitted)

F23F1.10 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
83771	cel-miR-58b-3p	F23F1.10	154	-13.22	70.00	75.00
22694	cel-miR-80-3p	F23F1.10	149	-16.23	68.42	73.68
86559	cel-miR-2209a-3p	F23F1.10	148	-13.78	81.82	90.91
2042	cel-miR-2-5p	F23F1.10	146	-13.31	59.09	77.27
23884	cel-miR-81-3p	F23F1.10	145	-16.41	78.57	78.57
25075	cel-miR-82-3p	F23F1.10	145	-16.41	78.57	78.57
61328	cel-miR-785-3p	F23F1.10	144	-7.68	64.71	76.47
153198	cel-miR-58c	F23F1.10	144	-12.57	76.92	84.62
29668	cel-miR-86-5p	F23F1.10	140	-5.58	100.00	100.00