F23F1.5
F23F1.5 |
No description available.
Graphics for F23F1.5
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for F23F1.5
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 17001 -
Tier: 1 -
Name: F23F1.5 -
Cosmid: F23F1.5 -
WBGeneID: WBGene00017746 -
Length: 200 -
PAS: AATAAA
Cluster Coverage (%): 3039 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 17001 | F23F1.5 | II | - | 29918 | 30116 | 200nt | AATAAA (-28nt) | 3039 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
 |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|200nt|II:29918..30116|PAS:AATAAA
auguuuuuuauuuauucauuauuuuauuccccccccccccccccccuauuuuccaauuuccuuuucagguaaguuuuacc cuuuucgugucagaguacuaacucucucucuucuugucuucaacuucuuuuucuucguugaaaaaagaaauauaauccuu uuguaugucgaaauaaauauuauuguguucuucuuguuc
Updated miRanda Targets for F23F1.5 (Murari et al., submitted)
F23F1.5 transcript has been predicted to be targeted by the following miRNAs:| ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
|---|---|---|---|---|---|---|
| 148151 | cel-miR-8207-3p | F23F1.5 | 152 | -8.45 | 73.33 | 80.00 | 98512 | cel-miR-4806-5p | F23F1.5 | 147 | -10.72 | 71.43 | 78.57 | 65759 | cel-miR-792-5p | F23F1.5 | 143 | -9.84 | 57.14 | 71.43 |
External Databases
More on F23F1.5
Related Papers
There are no recent papers related to F23F1.5.
The APAome Project is currently funded by the School of Life Sciences at Arizona State University