srd-3

K10B4.5 | Serpentine Receptor, Class D (delta) 3

No description available.

Graphics for srd-3

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for srd-3

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 4099 - Tier: 1 - Name: srd-3 - Cosmid: K10B4.5 - WBGeneID: WBGene00005081 - Length: 169 - PAS: aatgaa
Cluster Coverage (%): 24 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
4099	srd-3	II	-	126771	126938	169nt	aatgaa (-19nt)	24 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|169nt|II:126771..126938|PAS:aatgaa
uaccuucuauugucacaagcaugaaaagaagcgggaaaauuaaauuacaacgauaacaauacaaaacgggcacauuuuga
acuuugugaauauauauuuuaaaacuagucucauguacauauugcugcuuuuuguguaaauuuugcaauaaugaaacuuu
cuguuuua

Updated miRanda Targets for srd-3 (Murari et al., submitted)

srd-3 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
28277	cel-miR-85-3p	srd-3	156	-15.82	72.22	83.33
62885	cel-miR-788-5p	srd-3	152	-19.38	72.73	72.73
73510	cel-miR-1019-3p	srd-3	148	-10.19	63.64	68.18
20341	cel-miR-76-3p	srd-3	147	-11.84	71.43	78.57
69820	cel-miR-797-3p	srd-3	144	-8.28	76.92	84.62
58219	cel-lsy-6-3p	srd-3	140	-8.91	100.00	100.00
59564	cel-miR-784-3p	srd-3	140	-10.47	100.00	100.00
141610	cel-miR-8199-3p	srd-3	140	-11.25	100.00	100.00