Y47G6A.21
Y47G6A.21 |
No description available.
Graphics for Y47G6A.21
3'UTR Zoom
Locus
see this gene in GBrowse
Operon Information
This gene is part of the operon CEOP1914 (I:3578690..3551967)CEOP1914 contains 3 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse
3'UTR mapped for Y47G6A.21
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 21245 -
Tier: 1 -
Name: Y47G6A.21 -
Cosmid: Y47G6A.21 -
WBGeneID: WBGene00021646 -
Length: 53 -
PAS: aatgaa
Cluster Coverage (%): 1345 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 21245 | Y47G6A.21 | I | - | 3551953 | 3552004 | 53nt | aatgaa (-20nt) | 1345 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
 |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|53nt|I:3551953..3552004|PAS:aatgaa
agaauauaugauuuauuguuuugaaaauugagaaugaaguaaauuuguacca
External Databases
More on Y47G6A.21
Related Papers
There are no recent papers related to Y47G6A.21.
The APAome Project is currently funded by the School of Life Sciences at Arizona State University