Y47G6A.22

Y47G6A.22 |

No description available.

Graphics for Y47G6A.22

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1914 (I:3578690..3551967)
CEOP1914 contains 3 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for Y47G6A.22

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 21247 - Tier: 1 - Name: Y47G6A.22 - Cosmid: Y47G6A.22 - WBGeneID: WBGene00021647 - Length: 73 - PAS: AATAAA
Cluster Coverage (%): 4060 reads (78.30%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
21247	Y47G6A.22	I	-	3559923	3559994	73nt	AATAAA (-22nt)	4060 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|73nt|I:3559923..3559994|PAS:AATAAA
auauuagcuuuuuugucucauauugagauuguuuugaacuuuuaucauguaauaaauagagagauacaugua

2 ID: 21246 - Tier: 1 - Name: Y47G6A.22 - Cosmid: Y47G6A.22 - WBGeneID: WBGene00021647 - Length: 82 - PAS: gataca
Cluster Coverage (%): 1127 reads (21.70%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
21246	Y47G6A.22	I	-	3559914	3559994	82nt	gataca (-19nt)	1127 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|82nt|I:3559914..3559994|PAS:gataca
auauuagcuuuuuugucucauauugagauuguuuugaacuuuuaucauguaauaaauagagagauacauguauuuuuuuu
a

Updated miRanda Targets for Y47G6A.22 (Murari et al., submitted)

Y47G6A.22 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
142751	cel-miR-8201-3p	Y47G6A.22	155	-7.61	66.67	76.19
41023	cel-miR-246-3p	Y47G6A.22	147	-8.87	90.00	90.00
104534	cel-miR-4813-3p	Y47G6A.22	142	-12.28	57.14	76.19
51299	cel-miR-259-5p	Y47G6A.22	140	-8.22	100.00	100.00