Y47G6A.33

Y47G6A.33 |

No description available.

Graphics for Y47G6A.33

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for Y47G6A.33

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 23656 - Tier: 1 - Name: Y47G6A.33 - Cosmid: Y47G6A.33 - WBGeneID: WBGene00045399 - Length: 71 - PAS: aatgaa
Cluster Coverage (%): 5036 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
23656	Y47G6A.33	I	+	3564955	3565025	71nt	aatgaa (-30nt)	5036 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|71nt|I:3564955..3565025|PAS:aatgaa
uaagauauaaauaauccaaaaauuguuaggaaacuuaucaaaugaaacuaauaaauacuaguacaaauga

Updated miRanda Targets for Y47G6A.33 (Murari et al., submitted)

Y47G6A.33 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
33049	cel-miR-230-3p	Y47G6A.33	146	-10.34	65.00	70.00
37726	cel-miR-239a-5p	Y47G6A.33	145	-10.61	100.00	100.00
38128	cel-miR-239b-5p	Y47G6A.33	145	-9.46	100.00	100.00
70791	cel-miR-797-3p	Y47G6A.33	144	-8.68	81.82	81.82
37453	cel-miR-238-3p	Y47G6A.33	141	-9.81	75.00	75.00