pcaf-1

Y47G6A.6 | P300/CBP Associated Factor homolog 1

pcaf-1 encodes the sole C. elegans PCAF/GCN5-like histone acetyltransferase.

Graphics for pcaf-1

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for pcaf-1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 21233 - Tier: 1 - Name: pcaf-1 - Cosmid: Y47G6A.6 - WBGeneID: WBGene00021636 - Length: 149 - PAS: tataaa
Cluster Coverage (%): 627 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
21233	pcaf-1	I	+	3523250	3523398	149nt	tataaa (-25nt)	627 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|149nt|I:3523250..3523398|PAS:tataaa
uuguuaaucuguaaauaauucaauuuuuaucuuuauuaauuauauauugauuaagacgaucucuuuuauuuauuuauuau
acacuauauugauucagacuuuugugauuuuuugagaaaaaaauauaaaaauucauuaacaacgacga

Updated miRanda Targets for pcaf-1 (Murari et al., submitted)

pcaf-1 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
20475	cel-miR-76-3p	pcaf-1	172	-19.43	78.95	84.21
108309	cel-miR-4923a	pcaf-1	164	-12.05	68.42	84.21
104288	cel-miR-4813-3p	pcaf-1	158	-10.68	70.59	82.35
146051	cel-miR-8206-5p	pcaf-1	152	-6.20	73.68	78.95
12934	cel-miR-58a-3p	pcaf-1	149	-16.46	78.57	85.71
104289	cel-miR-4813-3p	pcaf-1	145	-10.68	100.00	100.00
119720	cel-miR-5546-3p	pcaf-1	145	-5.50	100.00	100.00

Predicted or Experimental Interactors for pcaf-1 (WormBase)

pcaf-1 has been predicted to interact with the following genes (data from WS200):

cdc-25.3 Lee I et al. (2008)
cdc-25.3 encodes a tyrosine phosphatase that is a member of the cell division cycle 25 (CDC25) family of cell cycle regulators that includes Schizosaccharomyces pombe CDC25 and Drosophila string; cdc-25.3 is one of four cdc-25 genes in C. elegans and while it is known to be expressed in hermaphrodites, the precise function of cdc-25.3 is not yet clear; cdc-25.3 may function redundantly with cdc-25.2 during embryonic development and redundantly with cdc-25.1, cdc-25.2, and emb-29 during meiosis.
ceh-44 Lee I et al. (2008)
ceh-44 encodes at least three proteins via alternative splicing; the CEH-44A protein is an ortholog of the CUX class of CUT homeodomain proteins, expressed in early embryos (mostly anterior in the comma stage), in the larval nerve ring and the adult gonad; the CUX class includes Drosophila CUT, human CUTL1 and human CUTL2; ceh-44 is a complex gene, in which two alternatively spliced protein products completely lack the homeodomain, and instead resemble vertebrate CASP proteins; CASP proteins are also found in plants and fungi (though not associated with homeodomains); like its orthologs, CEH-44A has three N-terminal cut domains in addition to a C-terminal CUT homeodomain; the cut domain may be a compact DNA-binding domain composed of alpha helices.
dlx-1 Lee I et al. (2008)
none available
elpc-3 Lee I et al. (2008)
none available
his-10 Lee I et al. (2008)
his-10 encodes an H4 histone.
his-11 Lee I et al. (2008)
his-11 encodes an H2B histone; by homology, HIS-11 is predicted to function as a nucleosome component required for packaging of DNA into chromatin; his-11 is a replication-dependent histone locus that resides in the HIS3 cluster on chromosome II.
his-12 Lee I et al. (2008)
his-12 encodes an H2A histone; his-12 is contained within the histone gene cluster HIS3.
his-13 Lee I et al. (2008)
his-13 encodes an H3 histone; his-13 is contained within the histone gene cluster HIS3.
his-14 Lee I et al. (2008)
his-14 encodes an H4 histone.
his-15 Lee I et al. (2008)
his-15 encodes an H2B histone.