C32E8.1

C32E8.1 |

No description available.

Graphics for C32E8.1

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for C32E8.1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15414 - Tier: 1 - Name: C32E8.1 - Cosmid: C32E8.1 - WBGeneID: WBGene00016320 - Length: 22 - PAS: AATAAA
Cluster Coverage (%): 39 reads (30.70%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15414	C32E8.1	I	+	3796684	3796705	22nt	AATAAA (-14nt)	39 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|22nt|I:3796684..3796705|PAS:AATAAA
aaauucgaauaaaugauuuga

2 ID: 15415 - Tier: 1 - Name: C32E8.1 - Cosmid: C32E8.1 - WBGeneID: WBGene00016320 - Length: 28 - PAS: AATAAA
Cluster Coverage (%): 88 reads (69.30%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15415	C32E8.1	I	+	3796684	3796711	28nt	AATAAA (-20nt)	88 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|28nt|I:3796684..3796711|PAS:AATAAA
aaauucgaauaaaugauuugaaaaaua

Links

Direct link to this page

External Databases

More on C32E8.1

» Browse with GBrowse

Related Papers

There are no recent papers related to C32E8.1.

Related c32e8.1 Genes

c32e8.1 none available...(more)

c32e8.11 none available...(more)

The APAome Project is currently funded by the School of Life Sciences at Arizona State University