ric-19
C32E8.7 | Resistance to Inhibitors of Cholinesterase 19
The ric-19 gene encodes an evolutionarily conserved cytosolic protein involved in neuroendocrine secretion via association with secretory vesicles.
Graphics for ric-19
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for ric-19
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 3568 -
Tier: 1 -
Name: ric-19 -
Cosmid: C32E8.7 -
WBGeneID: WBGene00004368 -
Length: 43 -
PAS: AATAAA
Cluster Coverage (%): 3740 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
3568 | ric-19 | I | - | 3778091 | 3778132 | 43nt | AATAAA (-19nt) | 3740 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|43nt|I:3778091..3778132|PAS:AATAAA
auguucuauguguaaaaucgaaaaauaaauguuuucaaacua
Updated miRanda Targets for ric-19 (Murari et al., submitted)
ric-19 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
26977 | cel-miR-85-5p | ric-19 | 158 | -10.63 | 86.67 | 86.67 |
Predicted or Experimental Interactors for ric-19 (WormBase)
ric-19 has been predicted to interact with the following genes (data from WS200):- ins-1 Lee I et al. (2008)
ins-1 encodes an insulin-like peptide orthologous to human insulin (INS; OMIM:176730, mutated in hyperproinsulinemia and diabetes mellitus type II); INS-1 is one of 38 insulin-like peptides in C. elegans and when overexpressed can antagonize insulin-like signaling mediated by DAF-2/IR leading to arrest at the dauer larval stage; loss of INS-1, however, does not result in a dauer phenotype suggesting that INS-1 functions redundantly with other insulin-like peptides to regulate reproductive growth and lifespan; a mutation in ins-1 does, however, show severe defects in salt chemotaxis learning; INS-1 is expressed in the amphid sensory neurons ASI and ASJ that regulate dauer arrest, the nerve ring, the intestine, vulval muscles, and other neurons.
More on ric-19
Related Papers
Related ric Genes
The APAome Project is currently funded by the School of Life Sciences at Arizona State University