ric-19

C32E8.7 | Resistance to Inhibitors of Cholinesterase 19

The ric-19 gene encodes an evolutionarily conserved cytosolic protein involved in neuroendocrine secretion via association with secretory vesicles.

Graphics for ric-19

3'UTR Zoom

Locus

see this gene in GBrowse

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for ric-19

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 3568 - Tier: 1 - Name: ric-19 - Cosmid: C32E8.7 - WBGeneID: WBGene00004368 - Length: 43 - PAS: AATAAA
Cluster Coverage (%): 3740 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
3568	ric-19	I	-	3778091	3778132	43nt	AATAAA (-19nt)	3740 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|43nt|I:3778091..3778132|PAS:AATAAA
auguucuauguguaaaaucgaaaaauaaauguuuucaaacua

Updated miRanda Targets for ric-19 (Murari et al., submitted)

ric-19 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
26977	cel-miR-85-5p	ric-19	158	-10.63	86.67	86.67

Predicted or Experimental Interactors for ric-19 (WormBase)

ric-19 has been predicted to interact with the following genes (data from WS200):

ins-1 Lee I et al. (2008)
ins-1 encodes an insulin-like peptide orthologous to human insulin (INS; OMIM:176730, mutated in hyperproinsulinemia and diabetes mellitus type II); INS-1 is one of 38 insulin-like peptides in C. elegans and when overexpressed can antagonize insulin-like signaling mediated by DAF-2/IR leading to arrest at the dauer larval stage; loss of INS-1, however, does not result in a dauer phenotype suggesting that INS-1 functions redundantly with other insulin-like peptides to regulate reproductive growth and lifespan; a mutation in ins-1 does, however, show severe defects in salt chemotaxis learning; INS-1 is expressed in the amphid sensory neurons ASI and ASJ that regulate dauer arrest, the nerve ring, the intestine, vulval muscles, and other neurons.

Links

Direct link to this page

External Databases

More on ric-19

» Browse with GBrowse

Related Papers

UNC-108/RAB-2 and its effector RIC-19 are involved in dense core vesicle maturation in Caenorhabditis elegans. Sumakovic, M, Hegermann, J, Luo, L, Husson, SJ, Schwarze, K, Olendrowitz, C, Schoofs, L, Richmond, J
J. Cell Biol. 2009-09-21

Related ric Genes

ric-1 ric-1 was identified in screens for mutations that confer resistance to acetylch...(more)

ric-3 ric-3 encodes a novel, highly charged protein with two transmembrane domains and...(more)

ric-4 ric-4 encodes an ortholog of vertebrate SNAP-25 and S. cerevisiae Sec9p; SNAP-25...(more)

ric-6 Uncloned locus that affects aldicarb sensitivity, indicating a possible effect o...(more)

ric-7 none available...(more)

ric-19 The ric-19 gene encodes an evolutionarily conserved cytosolic protein involved i...(more)

The APAome Project is currently funded by the School of Life Sciences at Arizona State University