C50D2.2

C50D2.2 |

No description available.

Graphics for C50D2.2

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for C50D2.2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15964 - Tier: 1 - Name: C50D2.2 - Cosmid: C50D2.2 - WBGeneID: WBGene00016806 - Length: 201 - PAS: tgttaa
Cluster Coverage (%): 890 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15964	C50D2.2	II	+	111230	111430	201nt	tgttaa (-19nt)	890 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|201nt|II:111230..111430|PAS:tgttaa
uuauaccuucuaaacucaucaguucuguaaauaaaccgcagucuccuuuuuauauuaauuuauguuuucuuuaaauauca
aaucucuccaaaugaacacugguuccucucguuuguacgcauuuccugucugugcuuccuaguauuuuaguuacuuucau
uucuuaguauuuuuguuuccuuguuaauaaaaaacuugua

Updated miRanda Targets for C50D2.2 (Murari et al., submitted)

C50D2.2 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
48822	cel-miR-255-5p	C50D2.2	155	-9.99	66.67	77.78
72766	cel-miR-1018	C50D2.2	151	-11.55	73.68	78.95
82614	cel-miR-1830-3p	C50D2.2	147	-12.20	68.75	81.25
58032	cel-lsy-6-5p	C50D2.2	145	-10.27	61.11	77.78
128144	cel-miR-5550-3p	C50D2.2	145	-6.34	100.00	100.00
141691	cel-miR-8199-3p	C50D2.2	142	-10.64	81.82	90.91
60429	cel-miR-785-5p	C50D2.2	140	-13.87	100.00	100.00