UTRome

col-68

C50D2.4 | COLlagen 68

No description available.

Graphics for col-68

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for col-68

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 618 - Tier: 1 - Name: col-68 - Cosmid: C50D2.4 - WBGeneID: WBGene00000644 - Length: 89 - PAS: gataaa
Cluster Coverage (%): 94 reads (30.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
618 col-68 II + 105722 105810 89nt gataaa (-19nt) 94 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|89nt|II:105722..105810|PAS:gataaa
uuuucugaacuuuaagccgacuguauugucuuucauagcccuauuucuguucaaccgguagauuuauucgauaaaucaca
auuuuuua

2 ID: 619 - Tier: 1 - Name: col-68 - Cosmid: C50D2.4 - WBGeneID: WBGene00000644 - Length: 113 - PAS: aatgaa
Cluster Coverage (%): 219 reads (70.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
619 col-68 II + 105722 105834 113nt aatgaa (-19nt) 219 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|113nt|II:105722..105834|PAS:aatgaa
uuuucugaacuuuaagccgacuguauugucuuucauagcccuauuucuguucaaccgguagauuuauucgauaaaucaca
auuuuuuaaucauaaugaaaauuuauucacga


Updated miRanda Targets for col-68 (Murari et al., submitted)

col-68 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
143201 cel-miR-8202-5p col-68 159 -17.58 72.22 77.78
18250 cel-miR-71-5p col-68 151 -17.44 68.75 87.50
121021 cel-miR-5546-3p col-68 147 -8.29 90.00 90.00
70852 cel-miR-797-3p col-68 144 -8.78 76.92 84.62
141046 cel-miR-8198-5p col-68 140 -10.50 100.00 100.00



Predicted or Experimental Interactors for col-68 (WormBase)

col-68 has been predicted to interact with the following genes (data from WS200):

  • clec-107 Lee I et al. (2008)
    none available
  • clx-1 Lee I et al. (2008)
    clx-1 encodes a protein that contains 23 copies of a 15 amino acid repeat, possibly derived from a collagen triplet; there is no transcript evidence for this locus.
  • col-104 Lee I et al. (2008)
    none available
  • col-111 Lee I et al. (2008)
    none available
  • col-173 Lee I et al. (2008)
    none available
  • col-174 Lee I et al. (2008)
    none available
  • col-182 Lee I et al. (2008)
    none available
  • col-54 Lee I et al. (2008)
    none available
  • col-55 Lee I et al. (2008)
    none available
  • col-65 Lee I et al. (2008)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001