col-68
C50D2.4 | COLlagen 68
No description available.
Graphics for col-68
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for col-68
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 618 -
Tier: 1 -
Name: col-68 -
Cosmid: C50D2.4 -
WBGeneID: WBGene00000644 -
Length: 89 -
PAS: gataaa
Cluster Coverage (%): 94 reads (30.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
618 | col-68 | II | + | 105722 | 105810 | 89nt | gataaa (-19nt) | 94 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|89nt|II:105722..105810|PAS:gataaa
uuuucugaacuuuaagccgacuguauugucuuucauagcccuauuucuguucaaccgguagauuuauucgauaaaucaca auuuuuua
2
ID: 619 -
Tier: 1 -
Name: col-68 -
Cosmid: C50D2.4 -
WBGeneID: WBGene00000644 -
Length: 113 -
PAS: aatgaa
Cluster Coverage (%): 219 reads (70.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
619 | col-68 | II | + | 105722 | 105834 | 113nt | aatgaa (-19nt) | 219 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|113nt|II:105722..105834|PAS:aatgaa
uuuucugaacuuuaagccgacuguauugucuuucauagcccuauuucuguucaaccgguagauuuauucgauaaaucaca auuuuuuaaucauaaugaaaauuuauucacga
Updated miRanda Targets for col-68 (Murari et al., submitted)
col-68 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
143201 | cel-miR-8202-5p | col-68 | 159 | -17.58 | 72.22 | 77.78 | 18250 | cel-miR-71-5p | col-68 | 151 | -17.44 | 68.75 | 87.50 | 121021 | cel-miR-5546-3p | col-68 | 147 | -8.29 | 90.00 | 90.00 | 70852 | cel-miR-797-3p | col-68 | 144 | -8.78 | 76.92 | 84.62 | 141046 | cel-miR-8198-5p | col-68 | 140 | -10.50 | 100.00 | 100.00 |
Predicted or Experimental Interactors for col-68 (WormBase)
col-68 has been predicted to interact with the following genes (data from WS200):- clec-107 Lee I et al. (2008)
none available - clx-1 Lee I et al. (2008)
clx-1 encodes a protein that contains 23 copies of a 15 amino acid repeat, possibly derived from a collagen triplet; there is no transcript evidence for this locus. - col-104 Lee I et al. (2008)
none available - col-111 Lee I et al. (2008)
none available - col-173 Lee I et al. (2008)
none available - col-174 Lee I et al. (2008)
none available - col-182 Lee I et al. (2008)
none available - col-54 Lee I et al. (2008)
none available - col-55 Lee I et al. (2008)
none available - col-65 Lee I et al. (2008)
none available
More on col-68
Related Papers
There are no recent papers related to col-68.Related col Genes

The APAome Project is currently funded by the School of Life Sciences at Arizona State University