C50D2.5
C50D2.5 |
No description available.
Graphics for C50D2.5
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for C50D2.5
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 15966 -
Tier: 1 -
Name: C50D2.5 -
Cosmid: C50D2.5 -
WBGeneID: WBGene00016808 -
Length: 70 -
PAS: aatgaa
Cluster Coverage (%): 6813 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 15966 | C50D2.5 | II | + | 98893 | 98962 | 70nt | aatgaa (-23nt) | 6813 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
 |
 |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|70nt|II:98893..98962|PAS:aatgaa
auaucguguuucuuuaaaccuuauuuuaucauuucccucaaccuucaaugaaugauaauuucucuguga
Updated miRanda Targets for C50D2.5 (Murari et al., submitted)
C50D2.5 transcript has been predicted to be targeted by the following miRNAs:| ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
|---|---|---|---|---|---|---|
| 42540 | cel-miR-247-5p | C50D2.5 | 147 | -8.72 | 72.22 | 72.22 | 136756 | cel-miR-8190-5p | C50D2.5 | 143 | -13.62 | 61.11 | 77.78 |
External Databases
More on C50D2.5
Related Papers
There are no recent papers related to C50D2.5.
The APAome Project is currently funded by the School of Life Sciences at Arizona State University