C50D2.7

C50D2.7 |

No description available.

Graphics for C50D2.7

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP2012 (II:97942..88565)
CEOP2012 contains 4 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for C50D2.7

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15968 - Tier: 1 - Name: C50D2.7 - Cosmid: C50D2.7 - WBGeneID: WBGene00016810 - Length: 276 - PAS: AATAAA
Cluster Coverage (%): 1504 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15968	C50D2.7	II	-	92169	92443	276nt	AATAAA (-22nt)	1504 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|276nt|II:92169..92443|PAS:AATAAA
acuuucacauggugucggguuaucccaucacggguugauguacaagaaaugcgggauuucugcgucucgcucaccgcauu
uuuguagaucacaccgugaugggacacucugacaccacguguacuuuauuguaaaaauuuguucauucuccccauuuuuu
gccauuuuuuucauguauuuucucuuuuccccccaaagauucugugaauuuuguuaugauuaugugccuguaauuuuugu
aaauguaaauaguaauaaauacccuuuuuuuucua

Updated miRanda Targets for C50D2.7 (Murari et al., submitted)

C50D2.7 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
118109	cel-miR-5546-3p	C50D2.7	161	-14.71	68.75	93.75
5794	cel-miR-43-5p	C50D2.7	147	-13.62	68.42	73.68
42541	cel-miR-247-5p	C50D2.7	145	-8.46	100.00	100.00
44232	cel-miR-248	C50D2.7	145	-17.15	100.00	100.00
108033	cel-miR-4923a	C50D2.7	141	-9.58	87.50	100.00
105691	cel-miR-4816-3p	C50D2.7	140	-10.08	100.00	100.00