UTRome

C50D2.9

C50D2.9 |

No description available.

Graphics for C50D2.9

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.


Operon Information

This gene is part of the operon CEOP2012 (II:97942..88565)
CEOP2012 contains 4 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for C50D2.9

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15971 - Tier: 1 - Name: C50D2.9 - Cosmid: C50D2.9 - WBGeneID: WBGene00016812 - Length: 110 - PAS: tataaa
Cluster Coverage (%): 518 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
15971 C50D2.9 II - 88530 88638 110nt tataaa (-20nt) 518 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|110nt|II:88530..88638|PAS:tataaa
auugauuuuuuucauuguuuguguuauauuuauguuagccuuauauauuauguuagccuuauauuuauuauaguuucaau
uguugaaaauauaaauuucaggauaauga


Updated miRanda Targets for C50D2.9 (Murari et al., submitted)

C50D2.9 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
103277 cel-miR-4811-3p C50D2.9 148 -10.12 66.67 80.00
106757 cel-miR-4922 C50D2.9 140 -5.31 100.00 100.00




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001