C50D2.9
C50D2.9 |
No description available.
Graphics for C50D2.9
3'UTR Zoom
Locus
see this gene in GBrowse
Operon Information
This gene is part of the operon CEOP2012 (II:97942..88565)CEOP2012 contains 4 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse
3'UTR mapped for C50D2.9
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 15971 -
Tier: 1 -
Name: C50D2.9 -
Cosmid: C50D2.9 -
WBGeneID: WBGene00016812 -
Length: 110 -
PAS: tataaa
Cluster Coverage (%): 518 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
15971 | C50D2.9 | II | - | 88530 | 88638 | 110nt | tataaa (-20nt) | 518 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|110nt|II:88530..88638|PAS:tataaa
auugauuuuuuucauuguuuguguuauauuuauguuagccuuauauauuauguuagccuuauauuuauuauaguuucaau uguugaaaauauaaauuucaggauaauga
Updated miRanda Targets for C50D2.9 (Murari et al., submitted)
C50D2.9 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
103277 | cel-miR-4811-3p | C50D2.9 | 148 | -10.12 | 66.67 | 80.00 | 106757 | cel-miR-4922 | C50D2.9 | 140 | -5.31 | 100.00 | 100.00 |
More on C50D2.9
Related Papers
There are no recent papers related to C50D2.9.The APAome Project is currently funded by the School of Life Sciences at Arizona State University