abf-2
C50F2.10 | AntiBacterial Factor related 2
The abf-2 gene encodes an antimicrobial peptide that is homologous to antibacterial factor ASABF from Ascaris suum and closely related to ABF-1.
Graphics for abf-2
3'UTR Zoom
Locus
see this gene in GBrowse
Operon Information
This gene is part of the operon CEOP1951 (I:3887273..3885549)CEOP1951 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse
3'UTR mapped for abf-2
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 17 -
Tier: 1 -
Name: abf-2 -
Cosmid: C50F2.10 -
WBGeneID: WBGene00000013 -
Length: 85 -
PAS: AATAAA
Cluster Coverage (%): 1134 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
17 | abf-2 | I | - | 3885548 | 3885631 | 85nt | AATAAA (-22nt) | 1134 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|85nt|I:3885548..3885631|PAS:AATAAA
gcuuuauauauauuauacguuuuuuguauaaauuugugcacaauuuugauuuauuuauauuaaauaaauguuuuuuuccc ggca
Predicted or Experimental Interactors for abf-2 (WormBase)
abf-2 has been predicted to interact with the following genes (data from WS200):- abf-1 Lee I et al. (2008)
The abf-1 gene encodes a homolog of the antibacterial factor ASABF from Ascaris suum; it is closely related to abf-2.
More on abf-2
Related Papers
Related abf Genes
![SoLS](/UTRome/images/SOLS_RGB.png)
The APAome Project is currently funded by the School of Life Sciences at Arizona State University