abf-2

C50F2.10 | AntiBacterial Factor related 2

The abf-2 gene encodes an antimicrobial peptide that is homologous to antibacterial factor ASABF from Ascaris suum and closely related to ABF-1.

Graphics for abf-2

3'UTR Zoom

Locus

see this gene in GBrowse

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1951 (I:3887273..3885549)
CEOP1951 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for abf-2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17 - Tier: 1 - Name: abf-2 - Cosmid: C50F2.10 - WBGeneID: WBGene00000013 - Length: 85 - PAS: AATAAA
Cluster Coverage (%): 1134 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
17	abf-2	I	-	3885548	3885631	85nt	AATAAA (-22nt)	1134 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|85nt|I:3885548..3885631|PAS:AATAAA
gcuuuauauauauuauacguuuuuuguauaaauuugugcacaauuuugauuuauuuauauuaaauaaauguuuuuuuccc
ggca

Predicted or Experimental Interactors for abf-2 (WormBase)

abf-2 has been predicted to interact with the following genes (data from WS200):

abf-1 Lee I et al. (2008)
The abf-1 gene encodes a homolog of the antibacterial factor ASABF from Ascaris suum; it is closely related to abf-2.

Links

Direct link to this page

External Databases

More on abf-2

» Browse with GBrowse

Related Papers

Resistance to antimicrobial peptides contributes to persistence of Salmonella typhimurium in the C. elegans intestine. Alegado, RA
Cell. Microbiol. 2008-06-01

Overexpression of an antimicrobial peptide derived from C. elegans using an aggregation-prone protein coexpression system. Tomisawa, S, Hojo, E, Umetsu, Y, Ohki, S, Kato, Y, Miyazawa, M, Mizuguchi, M, Kamiya, M, Kumaki, Y,
AMB Express 0000-00-00

Related abf Genes

abf-1 The abf-1 gene encodes a homolog of the antibacterial factor ASABF from Ascaris ...(more)

abf-2 The abf-2 gene encodes an antimicrobial peptide that is homologous to antibacter...(more)

abf-3 abf-3 encodes a homolog of the antibacterial factor ASABF from Ascaris suum; ABF...(more)

abf-4 abf-4 encodes a homolog of the antibacterial factor ASABF from Ascaris suum; ABF...(more)

abf-5 The abf-5 gene encodes a homolog of the antibacterial factor ASABF from Ascaris ...(more)

abf-6 abf-6 encodes a homolog of the antibacterial factor ASABF from Ascaris suum; ABF...(more)

The APAome Project is currently funded by the School of Life Sciences at Arizona State University