C50F2.2

C50F2.2 |

No description available.

Graphics for C50F2.2

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1128 (I:3888315..3877065)
CEOP1128 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for C50F2.2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15996 - Tier: 1 - Name: C50F2.2 - Cosmid: C50F2.2 - WBGeneID: WBGene00016836 - Length: 99 - PAS: tattta
Cluster Coverage (%): 1436 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
15996	C50F2.2	I	+	3888215	3888313	99nt	tattta (-6nt)	1436 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|99nt|I:3888215..3888313|PAS:tattta
aauaauucauaauauaccugcauaauaauuuugcuuuaauuuuuuauucauuuguacuuugucaauauccgaugauuaug
aaauuuguagaauauuua

Updated miRanda Targets for C50F2.2 (Murari et al., submitted)

C50F2.2 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
105692	cel-miR-4816-3p	C50F2.2	168	-12.11	73.68	84.21
14065	cel-miR-60-3p	C50F2.2	155	-8.82	69.57	73.91
28565	cel-miR-85-3p	C50F2.2	153	-11.91	68.42	78.95
118122	cel-miR-5546-3p	C50F2.2	146	-9.22	57.89	78.95
59053	cel-miR-392-3p	C50F2.2	141	-10.94	90.00	90.00
128147	cel-miR-5550-3p	C50F2.2	140	-10.43	100.00	100.00