UTRome

C50F2.3

C50F2.3 |

No description available.

Graphics for C50F2.3

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.


Operon Information

This gene is part of the operon CEOP1128 (I:3888315..3877065)
CEOP1128 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for C50F2.3

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 15997 - Tier: 1 - Name: C50F2.3 - Cosmid: C50F2.3 - WBGeneID: WBGene00016837 - Length: 62 - PAS: AATAAA
Cluster Coverage (%): 1111 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
15997 C50F2.3 I + 3880684 3880745 62nt AATAAA (-18nt) 1111 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|62nt|I:3880684..3880745|PAS:AATAAA
uuuucauuauuuuuuauuuuauuuguuguucaggaucuugaaaaauaaauuauuuauuuua



 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001