abf-1
C50F2.9 | AntiBacterial Factor related 1
The abf-1 gene encodes a homolog of the antibacterial factor ASABF from Ascaris suum; it is closely related to abf-2.
Graphics for abf-1
3'UTR Zoom
Locus
see this gene in GBrowse
Operon Information
This gene is part of the operon CEOP1951 (I:3887273..3885549)CEOP1951 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse
3'UTR mapped for abf-1
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 16 -
Tier: 1 -
Name: abf-1 -
Cosmid: C50F2.9 -
WBGeneID: WBGene00000012 -
Length: 39 -
PAS: aatgaa
Cluster Coverage (%): 139 reads (39.20%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 16 | abf-1 | I | - | 3886074 | 3886111 | 39nt | aatgaa (-19nt) | 139 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
 |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|39nt|I:3886074..3886111|PAS:aatgaa
ccauauuuauauguuugugaaugaaucgcgaaauguga
2
ID: 15 -
Tier: 1 -
Name: abf-1 -
Cosmid: C50F2.9 -
WBGeneID: WBGene00000012 -
Length: 50 -
PAS: aatgaa
Cluster Coverage (%): 216 reads (60.80%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 15 | abf-1 | I | - | 3886063 | 3886111 | 50nt | aatgaa (-30nt) | 216 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
|
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|50nt|I:3886063..3886111|PAS:aatgaa
ccauauuuauauguuugugaaugaaucgcgaaaugugaccuuuuuugga
Updated miRanda Targets for abf-1 (Murari et al., submitted)
abf-1 transcript has been predicted to be targeted by the following miRNAs:| ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
|---|---|---|---|---|---|---|
| 89709 | cel-miR-2216-5p | abf-1 | 141 | -11.48 | 87.50 | 100.00 |
External Databases
More on abf-1
Related Papers
Related abf Genes
The APAome Project is currently funded by the School of Life Sciences at Arizona State University