UTRome

D1037.1

D1037.1 |

No description available.

Graphics for D1037.1

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for D1037.1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 16211 - Tier: 1 - Name: D1037.1 - Cosmid: D1037.1 - WBGeneID: WBGene00017025 - Length: 84 - PAS: aatcaa
Cluster Coverage (%): 313 reads (33.70%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
16211 D1037.1 I + 3690047 3690130 84nt aatcaa (-15nt) 313 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|84nt|I:3690047..3690130|PAS:aatcaa
aauauaaucucaauucaucaguucaucaucauuguuguguuuucucgucuuuucaauugucuaauaacaaucaauuaauu cua

2 ID: 16212 - Tier: 1 - Name: D1037.1 - Cosmid: D1037.1 - WBGeneID: WBGene00017025 - Length: 106 - PAS: tctaaa
Cluster Coverage (%): 616 reads (66.30%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
16212 D1037.1 I + 3690047 3690152 106nt tctaaa (-26nt) 616 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|106nt|I:3690047..3690152|PAS:tctaaa
aauauaaucucaauucaucaguucaucaucauuguuguguuuucucgucuuuucaauugucuaauaacaaucaauuaauu cuaaaaauuaaaguauccccaguca


Updated miRanda Targets for D1037.1 (Murari et al., submitted)

D1037.1 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
72117 cel-miR-800-5p D1037.1 143 -10.62 55.56 72.22




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001