D1037.1

D1037.1 |

No description available.

Graphics for D1037.1

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for D1037.1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 16211 - Tier: 1 - Name: D1037.1 - Cosmid: D1037.1 - WBGeneID: WBGene00017025 - Length: 84 - PAS: aatcaa
Cluster Coverage (%): 313 reads (33.70%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
16211	D1037.1	I	+	3690047	3690130	84nt	aatcaa (-15nt)	313 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|84nt|I:3690047..3690130|PAS:aatcaa
aauauaaucucaauucaucaguucaucaucauuguuguguuuucucgucuuuucaauugucuaauaacaaucaauuaauu
cua

2 ID: 16212 - Tier: 1 - Name: D1037.1 - Cosmid: D1037.1 - WBGeneID: WBGene00017025 - Length: 106 - PAS: tctaaa
Cluster Coverage (%): 616 reads (66.30%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
16212	D1037.1	I	+	3690047	3690152	106nt	tctaaa (-26nt)	616 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|106nt|I:3690047..3690152|PAS:tctaaa
aauauaaucucaauucaucaguucaucaucauuguuguguuuucucgucuuuucaauugucuaauaacaaucaauuaauu
cuaaaaauuaaaguauccccaguca