smp-2

3'UTR mapped for smp-2

1 ID: 3898 - Tier: 1 - Name: smp-2 - Cosmid: D1037.2 - WBGeneID: WBGene00004890 - Length: 638 - PAS: aatgaa
Cluster Coverage (%): 960 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|638nt|I:3666488..3667124|PAS:aatgaa
uugugauuuaacguguggaugagguuuuacugaggggaacgacacuccggugucccuaaaaguuuuugaaacgucacaug
gugucagacugucccauaccggcuugaucuaccuagaucuacgagaaucgcgggaauuuagaggcagaguuuucaacuga
uuuugcaugguugagaaaacacugacgucacauaguuugggagaaaaauuaucacauuuuuuguagaugaaaccguaaua
ugacagccugacaccaagugaaaauuggcaugcgccuagaaccaauaguuauuauuaaaaauucaaaacauuugaguuuu
gaauaaucucaaaguuugaagcguaaauuuccaggagcccauguuucaaaauuucgagcguacuccaaaaaaucauagcc
ccauucaaaaaaacccacaaacauacauuuuaguuacacaauagcuuccuuuccaguuccaaagcucacggguauccuaa
auaaauucaauuuucaaaauauucggguuucaaacuucuagaaccaauucauucgucagauauuucuauuugucuuguaa
aauuaauuuauuuuucugcuuuucucuugucauugccauguguuuucaaaauagcaaaugaauuguuuuuuuuucga

Updated miRanda Targets for smp-2 (Murari et al., submitted)

Predicted or Experimental Interactors for smp-2 (WormBase)

• ced-1 Lee I et al. (2008)
  The ced-1 gene encodes a transmembrane protein on phagocytic cells that is homologous to human CD91, a low density lipoprotein receptor paralog; the cytoplasmic tail of CED-1 contains two motifs important for engulfment.
• mrck-1 Lee I et al. (2008)
  
• plx-1 Lee I et al. (2008)
  plx-1 encodes a C. elegans plexin ortholog; by homology, PLX-1 is predicted to function as a semaphorin receptor whose activity is required for proper positioning of the ray 1 cells in the male tail; genetic analyses indicate that while plx-1 functions in the same genetic pathway as the smp-1 and smp-2 semaphorin-encoding genes to position ray 1 cells, it functions in parallel to unc-73/GEF and the ced-10, mig-2, and rho-1 GTPase genes in affecting ray 1 position; plx-1 reporter gene fusions are expressed in all body wall muscles, male sex-specific muscles, and lateral hypodermal cells during postembryonic development; in the male tail, during the L3 larval stage when ray 1 cells are positioned, the plx-1 reporter is expressed predominantly in cells of the ray 1 and ray 2 lineages, with weaker and transient expression visible in the more posterior 3-9 rays.
• rho-1 Lee I et al. (2008)
  rho-1 encodes a Rho GTPase; rho-1 activity is required for regulation of a number of actin filament-based processes including embryonic polarity, cell migration, cell shape changes, muscle contraction, and neurite outgrowth; in addition, RHO-1 is required for both DGK-1- and UNC-13-dependent and independent regulation of synaptic signaling at neuromuscular junctions; as RHO-1 binds DGK-1 in vitro, its regulation of DGK-1-mediated signaling may be direct; in vitro RHO-1 GTPase activity is enhanced by the RGA-3 and RGA-4 GAP proteins, consistent with genetic studies showing that, in the early embryo, RHO-1 activity is required for expression of the rga-3/4(RNAi) hypercontractibility phenotype; RHO-1 is ubiquitously expressed throughout development with notably high expression seen in head neurons and asymmetric expression seen in the anterior cortex of one-cell embryos.
• smp-1 Lee I et al. (2008)
  none available
• unc-18 Lee I et al. (2008)
  unc-18 encodes the C. elegans ortholog of Saccharomyces cervisiae SEC1 and mammalian Munc18 proteins; UNC-18 function as a chaperone for UNC-64/syntaxin, ensuring its anterograde transport from the endoplasmic reticulum to the plasma membrane; UNC-18 also enables the docking of vesicles to synaptic regions before vesicle priming and fusion, and promotes synaptic vesicle exocytosis; UNC-18 may also inhibit excessive exocytosis; UNC-18 is expressed in ventral cord motor neurons.
• unc-7 Lee I et al. (2008)
  unc-7 encodes an innexin required for gap junction formation in invertebrates; UNC-7 is also required for normal locomotion, egg-laying, inhibition of feeding by tapping, avermectin sensitivity, and ivermectin sensitivity, as well as for the antagonism of UNC-79 and UNC-80 activity by volatile anesthetics; unc-7 is genetically required, and transcribed in, neurons rather than muscle cells, from larval stages L1 through L4; homologs of UNC-7 include Drosophila OGRE and SHAKING-B, as well as 24 C. elegans paralogs (including EAT-5, UNC-9, and INX-1 through INX-20); UNC-7 genetically interacts with UNC-124, and unc-7 mutants are phenotypically similar to unc-9 and unc-124 mutants; UNC-7 genetically interacts with AVR-14 and GLC-1 in the response to ivermectin.
• unc-73 Lee I et al. (2008)
  unc-73 encodes a guanine nucleotide exchange factor (GNEF) similar to the Trio protein; UNC-73 is required for vulval morphogenesis, for the migration of QL, QR, CAN, and hypodermal P cells, the commissure outgrowth of D type motoneurons, and amphid axon outgrowth; UNC-73 has GNEF activity for both CED-10 and MIG-2 in vitro; the requirement for UNC-73 in P cell migration can be suppressed by transgenic overexpression of rho-1; UNC-73 activates several small GTPases: RHO-1 in P cell migration, and both CED-10 and MIG-2 in vulval morphogenesis, P cell migration, and axon outgrowth.
• vps-11 Lee I et al. (2008)
  

Links

External Databases