UTRome

rab-8

D1037.4 | RAB family 8

rab-8 encodes a rab related protein of the Ras GTPase superfamily that affects ovarian morphology and function, thereby affecting fertility; acts downstream of let-60 with respect to vulval development based on genetic analysis.

Graphics for rab-8

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for rab-8

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 3467 - Tier: 1 - Name: rab-8 - Cosmid: D1037.4 - WBGeneID: WBGene00004272 - Length: 383 - PAS: attgca
Cluster Coverage (%): 6546 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
3467 rab-8 I - 3682890 3683271 383nt attgca (-16nt) 6546 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|383nt|I:3682890..3683271|PAS:attgca
auuuauugcucucucgccauguucugcccuuuucgaaguugauugugauucaauucaauucaacuucaauaguguaccau
aucucuuuucauauuuucuuuccguuugaauuuucuguuccaaaaacuccuccuucgcacauuuuuguaugcaguacggu
uauaauucuaaaaauaaccuuuuuucuucucucuucucuucugaccauaauaaccaacacuugcuuuguuuuuaccauuu
ucgucccgucuauuucucuguguccgcucucucucgcauauucaauucaccccccuacacccagcauucugaugagauuu
cuuuucaggauuucagauuuauuuuuuucgcgaauguaugaaccaaauugcauguuuuccca


Updated miRanda Targets for rab-8 (Murari et al., submitted)

rab-8 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
50879 cel-miR-259-5p rab-8 170 -21.45 84.21 84.21
148916 cel-miR-8208-3p rab-8 165 -20.56 70.00 80.00
150932 cel-miR-8210-3p rab-8 164 -15.41 72.73 77.27
84179 cel-miR-2207-5p rab-8 161 -16.70 75.00 87.50
8371 cel-miR-47-5p rab-8 155 -14.58 78.57 85.71
142864 cel-miR-8202-5p rab-8 155 -15.41 100.00 100.00
151306 cel-miR-2217b-1-5p rab-8 151 -20.24 90.00 100.00
8372 cel-miR-47-5p rab-8 150 -13.23 68.42 73.68
8012 cel-miR-46-5p rab-8 150 -13.23 68.42 73.68
20840 cel-miR-77-3p rab-8 149 -16.90 76.47 82.35
109362 cel-miR-4925 rab-8 148 -12.80 68.42 73.68
8013 cel-miR-46-5p rab-8 147 -11.70 71.43 78.57
66001 cel-miR-792-3p rab-8 145 -9.38 78.57 78.57
107307 cel-miR-4923a rab-8 145 -10.44 65.00 70.00
11712 cel-miR-55-5p rab-8 143 -12.28 68.75 75.00
41494 cel-miR-247-5p rab-8 141 -9.44 90.00 90.00
5273 cel-miR-42-5p rab-8 140 -19.02 100.00 100.00



Predicted or Experimental Interactors for rab-8 (WormBase)

rab-8 has been predicted to interact with the following genes (data from WS200):

  • agef-1 Lee I et al. (2008)
    agef-1 encodes a putative ARF guanine nucleotide exchange factor orthologous to human ARFGEF1 (OMIM:604141) and ARFGEF2 (OMIM:605371); agef-1(RNAi) inhibits CAV-1 body formation in oocytes more severely than arf-1 disruption alone, indicating that activation of both ARF-1 and ARF-3 by AGEF-1 may be required for transport of caveolin from Golgi to CAV-1 bodies during oogenesis; more generally, AGEF-1 is required in mass RNAi assays for embryonic and larval viability, embryonic osmotic integrity, normal neurotransmission, locomotion, and osmoregulation, and normally rapid growth.
  • arl-8 Lee I et al. (2008)
    none available
  • cct-2 Lee I et al. (2008)
  • cct-6 Lee I et al. (2008)
  • cdc-42 Lee I et al. (2008)
    cdc-42 encodes a RHO GTPase which controls polarity of both individual cells and developing embryos by regulating the localization of PAR proteins; CDC-42 is expressed at hypodermal cell boundaries; cdc-42 expression levels are unusually stable, with relatively little variation between adults, dauers, and L3 larvae, or between wild-type and daf-2(e1370ts) or daf-16(m26) mutant adults.
  • chc-1 Lee I et al. (2008)
    chc-1 encodes the C. elegans clathrin heavy chain ortholog; loss of chc-1 activity via RNAi results in defects in receptor-mediated yolk endocytosis and thus, embryonic lethality.
  • dnj-29 Lee I et al. (2008)
  • eft-3 Lee I et al. (2008)
    eft-3 encodes a translation elongation factor 1-alpha homolog that is required for embryonic viability, fertility, and germline maintenance; the EFT-3 protein sequence is encoded both by eft-3 (F31E3.5) itself but also by R03G5.1.
  • eft-4 Lee I et al. (2008)
    eft-4 encodes a translation elongation factor 1-alpha homolog that is required for embryonic viability, fertility, and a normal postembryonic growth rate; eft-4 encodes at least one alternatively spliced coding sequence identical to that of eft-3.
  • elpc-1 Lee I et al. (2008)
    Y110A7A.16 is orthologous to the human gene INHIBITOR OF KAPPA LIGHT POLYPEPTIDE GENE ENHANCER IN B-CELLS, KINASE COMPLEX-ASSOCIATED PROTEIN (IKBKAP; OMIM:603722), which when mutated leads to disease.


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001