F21A9.2
F21A9.2 |
No description available.
Graphics for F21A9.2
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for F21A9.2
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 16898 -
Tier: 1 -
Name: F21A9.2 -
Cosmid: F21A9.2 -
WBGeneID: WBGene00017651 -
Length: 71 -
PAS: gtttta
Cluster Coverage (%): 227 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
16898 | F21A9.2 | I | - | 3706028 | 3706097 | 71nt | gtttta (-14nt) | 227 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|71nt|I:3706028..3706097|PAS:gtttta
auggauaaaaauauauuuuaagaaauuagacaauuuauuuucagcucaauaaacggguuuuaauaauugu
More on F21A9.2
Related Papers
There are no recent papers related to F21A9.2.
The APAome Project is currently funded by the School of Life Sciences at Arizona State University