F28H1.1

F28H1.1 |

No description available.

Graphics for F28H1.1

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for F28H1.1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17179 - Tier: 1 - Name: F28H1.1 - Cosmid: F28H1.1 - WBGeneID: WBGene00017908 - Length: 550 - PAS: AATAAA
Cluster Coverage (%): 575 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
17179	F28H1.1	I	+	3996402	3996951	550nt	AATAAA (-20nt)	575 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|550nt|I:3996402..3996951|PAS:AATAAA
auucugaacaauaucccgaucuccuuuccuuuacuacucgguuacuauacacaaacggcuuauuuucauucucucaaauu
uugauagucacauaccuaauuauguuacggcuucugaaacuguuucaggugauuuaauucccauugcauuccucuuucca
aaagauauuugcaacuucuuauccuuuuauccuuuuaaucagaaauacgguuucucauugugauucuuuaauccuuaucg
uggcuuuugcaauaucaaaccaaaaucucuaagucucccuguuacaugucccauccgaucuucucguauaugcuccuagu
uauaauccuuuuuuaaucacaaaacauuaauaauccguacuacgguugaaacuuugcacuucccauaauccaucgauucc
auucaaaaaugcggucuccguccgauuucuugcuuuuucuuuucuucucauguuugcaucuucaugugauuucaccgaug
uguucaccuacuuuucugguuaauuuuuuaaaaugaauaacaccucuuuaauaaauaucugguaauuua

Updated miRanda Targets for F28H1.1 (Murari et al., submitted)

F28H1.1 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
53189	cel-miR-268	F28H1.1	157	-14.38	63.64	77.27
66328	cel-miR-792-3p	F28H1.1	157	-6.64	70.00	70.00
138372	cel-miR-8192-3p	F28H1.1	156	-15.13	78.95	78.95
103707	cel-miR-4813-5p	F28H1.1	155	-10.61	75.00	80.00
118453	cel-miR-5546-3p	F28H1.1	152	-8.06	57.89	78.95
50740	cel-miR-256	F28H1.1	147	-12.29	61.11	72.22
131720	cel-miR-5553-3p	F28H1.1	147	-16.91	61.11	72.22
12894	cel-miR-58a-3p	F28H1.1	140	-13.97	100.00	100.00
144538	cel-miR-4810b-3p	F28H1.1	140	-10.48	100.00	100.00