UTRome

cpn-3

F28H1.2 | CalPoNin 3

cpn-3 encodes a calponin homolog, most closely related to its paralog CPN-4 in C. elegans; CPN-3 is more similar to the calponin paralogs transgelin (SM22 alpha) or neuronal protein NP25 than to calponin per se.

Graphics for cpn-3

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for cpn-3

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 779 - Tier: 1 - Name: cpn-3 - Cosmid: F28H1.2 - WBGeneID: WBGene00000779 - Length: 147 - PAS: AATAAA
Cluster Coverage (%): 90970 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
779 cpn-3 I + 3988554 3988700 147nt AATAAA (-21nt) 90970 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|147nt|I:3988554..3988700|PAS:AATAAA
aaaccaacccauccaacucaagaauuccaaaaauggccaagcccuugcaauguuucacccgauaccuucucauauccuaa
uaauaugauuuucuucuuuucuucuuuuuuuguuguacaaaacaaaauaaaguuguuuggucaaca


Updated miRanda Targets for cpn-3 (Murari et al., submitted)

cpn-3 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
11203 cel-miR-54-5p cpn-3 157 -18.28 91.67 91.67
54253 cel-miR-355-5p cpn-3 140 -6.60 100.00 100.00



Predicted or Experimental Interactors for cpn-3 (WormBase)

cpn-3 has been predicted to interact with the following genes (data from WS200):

  • csq-1 Lee I et al. (2008)
  • lea-1 Lee I et al. (2008)
    The lea-1 gene encodes a protein that is predicted to be hydrophilic and heat-resistant, and that might participate in anhydrobiosis.
  • lec-5 Lee I et al. (2008)
    none available
  • pat-10 Lee I et al. (2008)
    pat-10 encodes body wall muscle troponin C, the calcium-binding component of the troponin complex of actin thin filaments; PAT-10 is essential for muscle contraction and thus for completion of embryonic morphogenesis and elongation; by homology, PAT-10 likely functions to regulate body wall muscle contraction in response to changes in intracellular calcium; PAT-10 is expressed in body wall muscle but is also detected in vulval and anal muscles; expression in body wall muscle begins during early embryonic morphogenesis, concurrent with expression of other body wall muscle structural components.
  • qdpr-1 Lee I et al. (2008)
    The T03F6.1 gene encodes an ortholog of the human gene QUINOID DIHYDROPTERIDINE REDUCTASE (QDPR; DHPR), which when mutated leads to phenylketonuria II (OMIM:261630).
  • rme-2 Lee I et al. (2008)
    rme-2 encodes a member of the low-density lipoprotein (LDL) receptor superfamily; RME-2 functions as the C. elegans yolk receptor whose activity is required for yolk uptake during oogenesis; RME-2 is expressed in developing oocytes where it localizes at or near the cell surface.
  • unc-27 Lee I et al. (2008)
    unc-27 encodes a troponin I isoform; unc-27 is required for coordinated motility and normal muscle morphology; structural analyses indicate that unc-27 is required for proper sarcomeric organization; unc-27/troponin I interacts with the body wall and pharynx types of troponin C; expression studies show that unc-27 is expressed in body wall, vulval and anal muscles.


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001