F47B3.4

F47B3.4 |

No description available.

Graphics for F47B3.4

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for F47B3.4

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17859 - Tier: 1 - Name: F47B3.4 - Cosmid: F47B3.4 - WBGeneID: WBGene00018528 - Length: 30 - PAS: AATAAA
Cluster Coverage (%): 234 reads (73.60%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
17859	F47B3.4	I	+	3962199	3962228	30nt	AATAAA (-16nt)	234 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|30nt|I:3962199..3962228|PAS:AATAAA
uuuuuguaacucgaauaaaauguuucaua

2 ID: 17860 - Tier: 1 - Name: F47B3.4 - Cosmid: F47B3.4 - WBGeneID: WBGene00018528 - Length: 36 - PAS: cataaa
Cluster Coverage (%): 84 reads (26.40%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
17860	F47B3.4	I	+	3962199	3962234	36nt	cataaa (-10nt)	84 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|36nt|I:3962199..3962234|PAS:cataaa
uuuuuguaacucgaauaaaauguuucauaaaauua

Links

Direct link to this page

External Databases

More on F47B3.4

» Browse with GBrowse

Related Papers

There are no recent papers related to F47B3.4.

Related f47b3.4 Genes

f47b3.4 none available...(more)

The APAome Project is currently funded by the School of Life Sciences at Arizona State University