UTRome

F47B3.6

F47B3.6 |

No description available.

Graphics for F47B3.6

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for F47B3.6

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17863 - Tier: 2 - Name: F47B3.6 - Cosmid: F47B3.6 - WBGeneID: WBGene00018530 - Length: 69 - PAS: acttcg
Cluster Coverage (%): 2 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
17863 F47B3.6 I - 3972095 3972162 69nt acttcg (-9nt) 2 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|69nt|I:3972095..3972162|PAS:acttcg
ugcuauaguuuucucaaugcagacaaagcaaaugaauccguggaauuuugaagaacaccacuucgcga


Updated miRanda Targets for F47B3.6 (Murari et al., submitted)

F47B3.6 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
111881 cel-miR-4936 F47B3.6 150 -14.77 80.00 80.00




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001