UTRome

hus-1

H26D21.1 | human HUS1 related 1

hus-1 encodes the C. elegans ortholog of the Schizosaccharomyces pombe Hus1 DNA damage checkpoint protein; in C. elegans, hus-1 activity is required for DNA damage-induced cell cycle arrest and apoptosis, telomere maintenance, and hence, genome stability and development; specifically, hus-1 is required for the CEP-1/p53-dependent increase in germline egl-1 expression following irradiation; a HUS-1::GFP fusion protein is detected in the nuclei of mitotic and meiotic germ cells, mature oocytes, embryos, and somatic larval cells, particularly those that are proliferating; while HUS-1 localization is generally diffuse throughout these nuclei, following irradiation, HUS-1 localizes to discrete foci that overlap with chromatin; HUS-1 nuclear localization is dependent upon the Rad9 homologue HPR-9 and upon the checkpoint protein MRT-2, with which it interacts in yeast two-hybrid and in vitro assays.

Graphics for hus-1

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for hus-1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 1976 - Tier: 1 - Name: hus-1 - Cosmid: H26D21.1 - WBGeneID: WBGene00002042 - Length: 80 - PAS: AATAAA
Cluster Coverage (%): 1601 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
1976 hus-1 I + 3699222 3699301 80nt AATAAA (-20nt) 1601 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|80nt|I:3699222..3699301|PAS:AATAAA
aaauaauguuuuuugucguuguuugaaugccuaauuuucuagaucucauaaauucugcaaauaaauuuuuuauuucuua


Updated miRanda Targets for hus-1 (Murari et al., submitted)

hus-1 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
48122 cel-miR-255-5p hus-1 145 -4.64 100.00 100.00
113842 cel-miR-5546-3p hus-1 141 -9.53 60.00 75.00



Predicted or Experimental Interactors for hus-1 (WormBase)

hus-1 has been predicted to interact with the following genes (data from WS200):

  • abl-1 Lee I et al. (2008)
  • arl-5 Lee I et al. (2008)
    arl-5 encodes a paralog of the ADP-ribosylation factor-like protein EVL-20; ARL-5 is an ortholog of mammalian ARL5.
  • atm-1 Lee I et al. (2008)
    atm-1 encodes an ortholog of human ATM (OMIM:208900) that is required for the checkpoint response to DNA damage; human ATM encodes a phosphatidylinositol-3 kinase homolog that is biochemically activated by cellular irradiation, and mutation of ATM leads to ataxia-telengiectasia.
  • ced-9 Lee I et al. (2008)
    ced-9 encodes the sole C. elegans homolog of the mammalian cell-death inhibitor Bcl-2; during development, CED-9 activity is essential for preventing cells from undergoing programmed cell death and CED-9 functions by binding and repressing the activity of CED-4, a protein similar to human APAF-1 that positively regulates CED-3 caspase activity; CED-9 localizes to mitochondria.
  • ceh-26 Lee I et al. (2008)
    ceh-26 encodes a protein that contains a prospero-related homeodomain; expressed in nuclei of the adult head, tail neurons, and one cell in the postdeirids.
  • cey-3 Lee I et al. (2008)
    cey-3 encodes a protein with a cold-shock/Y-box domain; CEY-3 associates with CGH-1, CEY-2, and CEY-4 in cytoplasmic particles of the gonad and early embryo.
  • chk-1 Lee I et al. (2008)
    chk-1 encodes a CHK1-like serine threonin protein kinase that affects fertility.
  • cpg-3 Lee I et al. (2008)
    cgp-3 encodes a putatively secreted protein with an N-terminal low-complexity domain containing 15 potential chondroitin attachment sites, and a C-terminal EGF-like region; cpg-3 mRNA is enriched in oogenesis, but CPG-3 has no obvious function in mass RNAi assays.
  • crn-1 Lee I et al. (2008)
    none available
  • egg-2 Lee I et al. (2008)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001