msh-2

H26D21.2 | MSH (MutS Homolog) family 2

The msh-2 gene encodes a DNA mismatch repair protein homolog that is orthologous to human MSH2 (OMIM:120435); mutation of the human MSH2 gene leads to hereditary non-polyposis colon cancer (OMIM:120436).

Graphics for msh-2

3'UTR Zoom

Locus

see this gene in GBrowse

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for msh-2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 2587 - Tier: 1 - Name: msh-2 - Cosmid: H26D21.2 - WBGeneID: WBGene00003418 - Length: 72 - PAS: AATAAA
Cluster Coverage (%): 1887 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
2587	msh-2	I	-	3694301	3694371	72nt	AATAAA (-18nt)	1887 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|72nt|I:3694301..3694371|PAS:AATAAA
cucaauuucauauuuuaucuuccuacaauucacguauuuuguuuuaaauugugaauaaaccuauuauuaga

Updated miRanda Targets for msh-2 (Murari et al., submitted)

msh-2 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
17673	cel-miR-70-3p	msh-2	148	-9.87	66.67	80.00
84149	cel-miR-2207-5p	msh-2	146	-12.80	90.91	90.91

Predicted or Experimental Interactors for msh-2 (WormBase)

msh-2 has been predicted to interact with the following genes (data from WS200):

ani-2 Lee I et al. (2008)
ani-2 encodes one of three C. elegans anillins; ANI-2 activity is required in the syncytial gonad for proper gonad structure and oocyte formation; specifically, ANI-2 appears to be required for maintaining the structure of the rachis, the syncytial compartment of germline cytoplasm that connects developing ooctyes; in the adult gonad, ANI-2 localizes to the surface of the rachis.
apb-3 Lee I et al. (2008)
apb-3 encodes an adaptin, orthologous to the beta3 subunit of adaptor protein complex 3 (AP-3); based on structural similarity, APB-3 is predicted to be involved in the formation of intracellular transport vesicles, and genetic analyses indicate that apb-3 activity is required for biogenesis of lysosome-related gut granules.
ars-1 Lee I et al. (2008)
ars-1 encodes an alanyl tRNA synthetase; on the basis of similarity to S. cerevisiae ALA1p, ARS-1 is probably cytoplasmic.
atm-1 Lee I et al. (2008)
atm-1 encodes an ortholog of human ATM (OMIM:208900) that is required for the checkpoint response to DNA damage; human ATM encodes a phosphatidylinositol-3 kinase homolog that is biochemically activated by cellular irradiation, and mutation of ATM leads to ataxia-telengiectasia.
brd-1 Lee I et al. (2008)
brd-1 encodes an ortholog of the BRCA1-associating protein BARD1 (OMIM:601593), associated with susceptibility to breast cancer; BRD-1 forms a heterodimer with BRC-1, which constitutes an E3 ubiquitin ligase; after irradiation, the DNA checkpoint proteins ATL-1 and MRE-11 are required for BRC-1/BRD-1 heterodimers to associate with the E2 ubiqutin-conjugating enzyme LET-70/Ubc5 and with RAD-51, and to ubiquitylate damaged chromatin; BRD-1 and BRC-1 bind one another, probably through their N-terminal RING domains, in yeast two-hybrid experiments and pull-down assays; BRC-1/BRD-1 heterodimers may interact with RAD-51 and other proteins via mutual binding to UBC-9; brd-1(RNAi) animals have excess chromosomal nondisjunction, abnormally high levels of CEP-1-dependent germ cell apoptosis (both with and without gamma-irradiation) and hypersensitivity to gamma-irradiation (e.g., abnormal sterility after irradiation); BRD-1 autoubiquitylation probably activates the BRC-1/BRD-1 heterodimer; BRD-1 binds SMT-3 (a Sumo homolog) and TAC-1; brd-1 is genetically dispensable for the induction of nuclear ATL-1 foci by gamma-irradiation or hydroxyurea.
car-1 Lee I et al. (2008)
cbp-1 Lee I et al. (2008)
cbp-1 encodes a homolog of the mammalian transcriptional cofactors CBP (OMIM:600140) and p300 (E1A-BINDING PROTEIN, 300-KD; OMIM:602700) that have been shown to possess histone acetyltransferase activity, and which, when mutated, lead to Rubinstein-Taybi syndrome (OMIM:180849) and colorectal cancer (OMIM:114500); at least one splicing form of CBP-1 exhibits histone acetyltransferase (HAT) activity in vitro and has a glutamine/asparagine-rich domain; CBP-1 is required during embryogenesis for differentiation of all non-neuronal somatic cell types; CBP-1 is expressed very early in embryogenesis, suggesting that it may interact with maternally provided transcription factors, such as SKN-1, to specific developmental fates.
cdc-25.1 Lee I et al. (2008)
cdc-25.1 encodes a CDC25 phosphatase homolog that affects embryonic viability, meiosis, mitosis, proliferation of the intestine (E cell lineage), and germ line proliferation; it is expressed in the developing germline, in the nuclei of oocytes, embryonic nuclei, nuclei of embryonic cortical membranes, and sperm pronuclei, and in the germline precursors Z2 and Z3.
cdc-25.3 Lee I et al. (2008)
cdc-25.3 encodes a tyrosine phosphatase that is a member of the cell division cycle 25 (CDC25) family of cell cycle regulators that includes Schizosaccharomyces pombe CDC25 and Drosophila string; cdc-25.3 is one of four cdc-25 genes in C. elegans and while it is known to be expressed in hermaphrodites, the precise function of cdc-25.3 is not yet clear; cdc-25.3 may function redundantly with cdc-25.2 during embryonic development and redundantly with cdc-25.1, cdc-25.2, and emb-29 during meiosis.
cdt-2 Lee I et al. (2008)