srt-54
K10B4.2 | Serpentine Receptor, class T 54
No description available.
Graphics for srt-54
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for srt-54
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 19010 -
Tier: 1 -
Name: srt-54 -
Cosmid: K10B4.2 -
WBGeneID: WBGene00019614 -
Length: 241 -
PAS: AATAAA
Cluster Coverage (%): 13 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
19010 | srt-54 | II | + | 118691 | 118931 | 241nt | AATAAA (-20nt) | 13 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|241nt|II:118691..118931|PAS:AATAAA
aaauuguuauuuuguuuuccuccuaucauaaaaaaauauuauaucucaucguaccagacaauuuuccauuucucagaagu uucucaaccuuucuagaauuguccagcacguuccacaaguuuucagcaaauucuagaacccuuucaauuucuggaacaaa uuaaaacuggaaucucccacauuuuuuuuaauugauaauuuuuuuuccucagucuugcucaauaaacacaagcaucuucu
Updated miRanda Targets for srt-54 (Murari et al., submitted)
srt-54 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
53495 | cel-miR-269 | srt-54 | 166 | -16.97 | 82.35 | 82.35 | 39879 | cel-miR-243-3p | srt-54 | 155 | -17.45 | 65.00 | 80.00 | 56682 | cel-miR-356a | srt-54 | 153 | -11.53 | 72.22 | 77.78 | 30799 | cel-miR-87-3p | srt-54 | 151 | -13.72 | 75.00 | 81.25 | 63537 | cel-miR-788-3p | srt-54 | 151 | -16.94 | 70.00 | 70.00 | 145969 | cel-miR-8206-5p | srt-54 | 149 | -5.40 | 68.75 | 75.00 | 71886 | cel-miR-800-5p | srt-54 | 148 | -14.31 | 66.67 | 77.78 | 35275 | cel-miR-233-3p | srt-54 | 144 | -14.83 | 66.67 | 73.33 | 92985 | cel-miR-2218b-3p | srt-54 | 144 | -7.62 | 57.89 | 68.42 | 118979 | cel-miR-5546-3p | srt-54 | 141 | -5.17 | 87.50 | 100.00 | 32530 | cel-miR-229-3p | srt-54 | 140 | -13.01 | 100.00 | 100.00 |
Predicted or Experimental Interactors for srt-54 (WormBase)
srt-54 has been predicted to interact with the following genes (data from WS200):More on srt-54
Related Papers
There are no recent papers related to srt-54.Related srt Genes
The APAome Project is currently funded by the School of Life Sciences at Arizona State University