UTRome

srt-54

K10B4.2 | Serpentine Receptor, class T 54

No description available.

Graphics for srt-54

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for srt-54

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19010 - Tier: 1 - Name: srt-54 - Cosmid: K10B4.2 - WBGeneID: WBGene00019614 - Length: 241 - PAS: AATAAA
Cluster Coverage (%): 13 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
19010 srt-54 II + 118691 118931 241nt AATAAA (-20nt) 13 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|241nt|II:118691..118931|PAS:AATAAA
aaauuguuauuuuguuuuccuccuaucauaaaaaaauauuauaucucaucguaccagacaauuuuccauuucucagaagu
uucucaaccuuucuagaauuguccagcacguuccacaaguuuucagcaaauucuagaacccuuucaauuucuggaacaaa
uuaaaacuggaaucucccacauuuuuuuuaauugauaauuuuuuuuccucagucuugcucaauaaacacaagcaucuucu


Updated miRanda Targets for srt-54 (Murari et al., submitted)

srt-54 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
53495 cel-miR-269 srt-54 166 -16.97 82.35 82.35
39879 cel-miR-243-3p srt-54 155 -17.45 65.00 80.00
56682 cel-miR-356a srt-54 153 -11.53 72.22 77.78
30799 cel-miR-87-3p srt-54 151 -13.72 75.00 81.25
63537 cel-miR-788-3p srt-54 151 -16.94 70.00 70.00
145969 cel-miR-8206-5p srt-54 149 -5.40 68.75 75.00
71886 cel-miR-800-5p srt-54 148 -14.31 66.67 77.78
35275 cel-miR-233-3p srt-54 144 -14.83 66.67 73.33
92985 cel-miR-2218b-3p srt-54 144 -7.62 57.89 68.42
118979 cel-miR-5546-3p srt-54 141 -5.17 87.50 100.00
32530 cel-miR-229-3p srt-54 140 -13.01 100.00 100.00



Predicted or Experimental Interactors for srt-54 (WormBase)

srt-54 has been predicted to interact with the following genes (data from WS200):

  • srab-22 Lee I et al. (2008)
    none available
  • srh-214 Lee I et al. (2008)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001