K10B4.3
K10B4.3 |
No description available.
Graphics for K10B4.3
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for K10B4.3
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 19011 -
Tier: 1 -
Name: K10B4.3 -
Cosmid: K10B4.3 -
WBGeneID: WBGene00019615 -
Length: 39 -
PAS: tataaa
Cluster Coverage (%): 334 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
19011 | K10B4.3 | II | - | 114431 | 114468 | 39nt | tataaa (-20nt) | 334 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|39nt|II:114431..114468|PAS:tataaa
uucaccugauuuuaauauuauaaacuuuauuuacaaua
More on K10B4.3
Related Papers
There are no recent papers related to K10B4.3.
The APAome Project is currently funded by the School of Life Sciences at Arizona State University