clec-53

T03F1.10 | C-type LECtin 53

No description available.

Graphics for clec-53

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for clec-53

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19662 - Tier: 1 - Name: clec-53 - Cosmid: T03F1.10 - WBGeneID: WBGene00020191 - Length: 31 - PAS: aataaa
Cluster Coverage (%): 463 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
19662	clec-53	I	-	3871474	3871503	31nt	aataaa (-18nt)	463 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|31nt|I:3871474..3871503|PAS:aataaa
auaauugauuugaauaaauaauuucaauua

Predicted or Experimental Interactors for clec-53 (WormBase)

clec-53 has been predicted to interact with the following genes (data from WS200):

chk-2 Lee I et al. (2008)
chk-2 encodes a member of the Cds1/Chk2 checkpoint kinase family, orthologous to human CHK2 (OMIM:604373, mutated in Li-Fraumeni syndrome), that affects pairing between homologous chromosomes during early meiotic prophase, and might function to couple premeiotic S phase with early prophase; CHK-2 is expressed in the germ line.
clec-49 Lee I et al. (2008)
none available
mlh-1 Lee I et al. (2008)
The mlh-1 gene encodes a DNA mismatch repair protein homolog that is orthologous to human MLH1.