clec-53
T03F1.10 | C-type LECtin 53
No description available.
Graphics for clec-53
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for clec-53
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 19662 -
Tier: 1 -
Name: clec-53 -
Cosmid: T03F1.10 -
WBGeneID: WBGene00020191 -
Length: 31 -
PAS: aataaa
Cluster Coverage (%): 463 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
19662 | clec-53 | I | - | 3871474 | 3871503 | 31nt | aataaa (-18nt) | 463 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|31nt|I:3871474..3871503|PAS:aataaa
auaauugauuugaauaaauaauuucaauua
Predicted or Experimental Interactors for clec-53 (WormBase)
clec-53 has been predicted to interact with the following genes (data from WS200):- chk-2 Lee I et al. (2008)
chk-2 encodes a member of the Cds1/Chk2 checkpoint kinase family, orthologous to human CHK2 (OMIM:604373, mutated in Li-Fraumeni syndrome), that affects pairing between homologous chromosomes during early meiotic prophase, and might function to couple premeiotic S phase with early prophase; CHK-2 is expressed in the germ line. - clec-49 Lee I et al. (2008)
none available - mlh-1 Lee I et al. (2008)
The mlh-1 gene encodes a DNA mismatch repair protein homolog that is orthologous to human MLH1.
More on clec-53
Related Papers
There are no recent papers related to clec-53.Related clec Genes
![SoLS](/UTRome/images/SOLS_RGB.png)
The APAome Project is currently funded by the School of Life Sciences at Arizona State University