UTRome

T03F1.11

T03F1.11 |

No description available.

Graphics for T03F1.11

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for T03F1.11

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19663 - Tier: 1 - Name: T03F1.11 - Cosmid: T03F1.11 - WBGeneID: WBGene00020192 - Length: 85 - PAS: AATAAA
Cluster Coverage (%): 4996 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
19663 T03F1.11 I + 3854155 3854239 85nt AATAAA (-20nt) 4996 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|85nt|I:3854155..3854239|PAS:AATAAA
aauucuuucaauuucuuaauguuuuaucuuuccaaaauuuauaacaaaucuaaacaaucucaacaauaaacaaucuauaa uaua


Updated miRanda Targets for T03F1.11 (Murari et al., submitted)

T03F1.11 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
49004 cel-miR-255-5p T03F1.11 147 -6.47 61.11 72.22
97489 cel-miR-4805-3p T03F1.11 143 -7.59 80.00 90.00




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001