pgk-1

T03F1.3 | PhosphoGlycerate Kinase 1

T03F1.3 is orthologous to the human gene PHOSPHOGLYCERETE KINASE 1 (PGK1; OMIM:311800), which when mutated leads to hemolytic anemia and neurologic disturbances.

Graphics for pgk-1

3'UTR Zoom

Locus

see this gene in GBrowse

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1124 (I:3870066..3867543)
CEOP1124 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for pgk-1

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19654 - Tier: 1 - Name: pgk-1 - Cosmid: T03F1.3 - WBGeneID: WBGene00020185 - Length: 154 - PAS: tataaa
Cluster Coverage (%): 3600 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
19654	pgk-1	I	+	3868957	3869110	154nt	tataaa (-23nt)	3600 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|154nt|I:3868957..3869110|PAS:tataaa
uuuucuaauuucuauuguuuauuccuugcccaauaguguauuuguauuuauucuuucucucucuaaaaacuuucccacau
uagucuugaauuguucccagugauuucacaaucuuccauguaacaugaaguauaaauaaaguguauaacuaua

Updated miRanda Targets for pgk-1 (Murari et al., submitted)

pgk-1 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
125576	cel-miR-5549-5p	pgk-1	162	-13.17	76.47	82.35
1095	cel-miR-1-5p	pgk-1	159	-13.73	82.35	82.35
66382	cel-miR-792-3p	pgk-1	155	-12.43	72.73	72.73
102752	cel-miR-4811-5p	pgk-1	149	-8.10	66.67	77.78
42802	cel-miR-247-5p	pgk-1	146	-7.54	63.64	72.73
101161	cel-miR-4809-3p	pgk-1	144	-15.78	81.82	81.82
10367	cel-miR-51-3p	pgk-1	141	-16.99	75.00	75.00

Predicted or Experimental Interactors for pgk-1 (WormBase)

pgk-1 has been predicted to interact with the following genes (data from WS200):

act-1 Lee I et al. (2008)
act-1 encodes an actin isoform that is required for proper body wall muscle and pharyngeal muscle structures and the motility of animals; actins have highly similar amino acid sequences; ACT-1 is identical to ACT-3; act-1 functions redundantly with two other actin isoforms, act-2 and act-3, to control cytoplasmic microfilament function in the early embryo.
act-2 Lee I et al. (2008)
act-2 encodes an invertebrate actin that may function specifically in the pharynx.
act-3 Lee I et al. (2008)
act-3 encodes an invertebrate actin, highly similar to ACT-1, ACT-2, and ACT-4, that functions in body wall muscle; act-3 functions with two other action isoforms, act-1 and act-2, to control cytoplasmic microfilament function in the early embryo.
act-5 Lee I et al. (2008)
an ortholog of human cytoplasmic actin; and is expressed only in microvillous intestinal cells and excretory cell.
alh-4 Lee I et al. (2008)
none available
asp-2 Lee I et al. (2008)
asp-2 encodes aspartic protease.
cts-1 Lee I et al. (2008)
cts-1 encodes a citrate synthase, predicted to be mitochondrial, that is required for embryonic development.
cyn-7 Lee I et al. (2008)
cyn-7 encodes a cyclophilin A isoform; while not tested for peptidyl-prolyl isomerase activity in vitro, it is very similar to CYN-3 and closely resembles the prototypical CypA, and is therefore likely to be a member of the cytosolic CsA-binding cyclophilin subfamily; CYN-7 was required for embryonic viability in one set of mass RNAi assays.
dhod-1 Lee I et al. (2008)
enol-1 Lee I et al. (2008)
T21B10.2 is orthologous to human ENOLASE 1 (also CRYSTALLIN, TAU; ENO1; OMIM:172430), which when mutated leads to spherocytic red cell enolase deficiency.