hcp-4

Operon Information

3'UTR mapped for hcp-4

1 ID: 1779 - Tier: 1 - Name: hcp-4 - Cosmid: T03F1.9 - WBGeneID: WBGene00001832 - Length: 104 - PAS: AATAAA
Cluster Coverage (%): 2167 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|104nt|I:3862833..3862935|PAS:AATAAA
agaaauaacuauugcuccacuauuuagcaaugucaaaaaacccaucuaaucccaauaccuguaaauaaugcaauuuuaaa
gggaauaaaguuugaaucuguca

Updated miRanda Targets for hcp-4 (Murari et al., submitted)

Predicted or Experimental Interactors for hcp-4 (WormBase)

• cul-2 Lee I et al. (2008)
  cul-2 encodes an E3 ubiquitin ligase; during development, CUL-2 functions as part of a Cul2-RING ubiquitin-ligase complex that regulates diverse biological processes, such as the initiation of meiotic anaphase II, cytokinesis and mitotic chromosome segregation, embryonic cell fate specification, and sex determination, via ubiquitin-mediated proteolysis; targets of CUL-2-mediated degradation include CYB-1/cyclin B and the zinc-finger protein TRA-1; CUL-2 is expressed in diverse cell types during embryonic and larval development and is also expressed in the adult germ line.
• elpc-3 Lee I et al. (2008)
  none available
• glh-1 Lee I et al. (2008)
  glh-1 encodes a putative DEAD-box RNA helicase that contains four CCHC zinc fingers and is homologous to Drosophila VASA, a germ-line-specific, ATP-dependent RNA helicase; at permissive temperature, GLH-1 is required redundantly with GLH-4 for proper germ-line development and fertility, specifically for regulating the normal extent of germ-line proliferation, oogenesis, and the production of functional sperm; GLH-1 activity is also likely required for the wild-type morphology of P granules and for localization of several protein components, such as PGL-1, but not for accumulation of P granule mRNAs; GLH-1 interacts in vivo with CSN-5, a COP9 signalosome component, and in vitro with itself and with KGB-1, a JNK-like MAP kinase, ZYX-1, a LIM domain-containing zyxin homologue, and GLH-3; GLH-1 is a constitutive P granule component and thus, with the exception of mature sperm, is expressed in germ cells at all stages of development; consistent with its P granule localization, GLH-1 is cytoplasmic in oocytes and the early embryo, while perinuclear in all later developmental stages as well as in the distal and medial regions of the hermaphrodite gonad; GLH-1 is also expressed in males.
• hcp-1 Lee I et al. (2008)
  hcp-1 encodes a homolog of the mammalian centromere protein-F (CENP-F) and is involved in mitotic chromosome segregation; hcp-1 functions in an ordered pathway consisting of two other CENP proteins encoded by hcp-3 and hcp-4 to control assembly of the kinetochore; hcp-1 localization to the kinetochore is dependent on hcp-3 and hcp-4.
• lst-3 Lee I et al. (2008)
  none available
• mis-12 Zhong W et al. (2006)
  mis-12 encodes the C. elegans homolog of human and Schizosaccharomyces pombe Mis12 protein; mis-12 activity is required for proper attachment of chromosomes to the mitotic spindle and thus, for embryonic development; MIS-12 localizes to the kinetochore throughout mitosis, and this localization requires the activity of KNL-3, a novel kinetochore component with which MIS-12 co-purifies as part of a large complex of interacting kinetochore proteins.
• nos-3 Lee I et al. (2008)
  nos-3 encodes a homolog of Drosophila NANOS that physically interacts with FBF-1 (similar, though not orthologous, to Drosophila PUMILIO); NOS-3 is required in development of the hermaphrodite germ-line to promote the switch from sperm to oocyte production, perhaps by forming a complex with FBF-1 that controls fem-3 mRNA.
• vps-39 Lee I et al. (2008)
  

Links

External Databases