T12F5.2

T12F5.2 |

No description available.

Graphics for T12F5.2

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1104 (I:3732924..3726013)
CEOP1104 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for T12F5.2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19955 - Tier: 1 - Name: T12F5.2 - Cosmid: T12F5.2 - WBGeneID: WBGene00020467 - Length: 108 - PAS: AATAAA
Cluster Coverage (%): 646 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
19955	T12F5.2	I	+	3732834	3732941	108nt	AATAAA (-21nt)	646 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|108nt|I:3732834..3732941|PAS:AATAAA
gcaauguuguacauuuauauuuaucuaccuacuuugucaaaauuuuuuauuguuucccauuucugacaacgaauuugaau
ucaucgaauaaaccagcucaaugacua

Updated miRanda Targets for T12F5.2 (Murari et al., submitted)

T12F5.2 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
3183	cel-miR-35-5p	T12F5.2	159	-14.45	85.71	85.71
28658	cel-miR-85-3p	T12F5.2	158	-9.38	73.68	78.95
60017	cel-miR-784-3p	T12F5.2	158	-11.89	80.00	93.33
63569	cel-miR-788-3p	T12F5.2	150	-11.60	57.14	71.43
119307	cel-miR-5546-3p	T12F5.2	150	-9.78	66.67	76.19
97511	cel-miR-4805-3p	T12F5.2	147	-6.54	90.00	90.00
20463	cel-miR-76-3p	T12F5.2	145	-13.76	66.67	86.67