UTRome

T12F5.2

T12F5.2 |

No description available.

Graphics for T12F5.2

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.


Operon Information

This gene is part of the operon CEOP1104 (I:3732924..3726013)
CEOP1104 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for T12F5.2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 19955 - Tier: 1 - Name: T12F5.2 - Cosmid: T12F5.2 - WBGeneID: WBGene00020467 - Length: 108 - PAS: AATAAA
Cluster Coverage (%): 646 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
19955 T12F5.2 I + 3732834 3732941 108nt AATAAA (-21nt) 646 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|108nt|I:3732834..3732941|PAS:AATAAA
gcaauguuguacauuuauauuuaucuaccuacuuugucaaaauuuuuuauuguuucccauuucugacaacgaauuugaau ucaucgaauaaaccagcucaaugacua


Updated miRanda Targets for T12F5.2 (Murari et al., submitted)

T12F5.2 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
3183 cel-miR-35-5p T12F5.2 159 -14.45 85.71 85.71
28658 cel-miR-85-3p T12F5.2 158 -9.38 73.68 78.95
60017 cel-miR-784-3p T12F5.2 158 -11.89 80.00 93.33
63569 cel-miR-788-3p T12F5.2 150 -11.60 57.14 71.43
119307 cel-miR-5546-3p T12F5.2 150 -9.78 66.67 76.19
97511 cel-miR-4805-3p T12F5.2 147 -6.54 90.00 90.00
20463 cel-miR-76-3p T12F5.2 145 -13.76 66.67 86.67




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001