UTRome

lin-59

T12F5.4 | abnormal cell LINeage 59

lin-59 encodes a SET domain-containing protein that is most closely related to the ASH1 group of histone-lysine N-methyltransferases; lin-59 was originally identified in screens for mutations that disrupt male tail development and subsequently was shown to be an essential gene required for development and fate specification of a number of different cells types, including those of the male tail, male and hermaphrodite hindgut, and egg-laying system; lin-59 has been shown to positively regulate expression of at least four genes: cdh-3, egl-5, mab-5, and nac-2; a lin-59::gfp reporter fusion is first expressed during the proliferative stage of embryonic development and expression continues, in most cells, throughout larval development and adulthood.

Graphics for lin-59

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for lin-59

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 2348 - Tier: 1 - Name: lin-59 - Cosmid: T12F5.4 - WBGeneID: WBGene00003040 - Length: 640 - PAS: aatgaa
Cluster Coverage (%): 1979 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
2348 lin-59 I - 3713126 3713764 640nt aatgaa (-26nt) 1979 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|640nt|I:3713126..3713764|PAS:aatgaa
aucuguacaucucucauuuucuccucauuaucagauaucaucauuaguuuacaacaguucacgaguugugguuuuagucc
ggugauacuacaacacacuaguacgugccucacccacauuccaucaguuuuuguuucguuuuaugugauauaaucucuca
cucucucucucguuuuuuccaucaagcaaaccuugauccuucuguuagaaaaauguagcuauaaaauacaauucuuuuug
auacaaacaagcauucuacucacuaucaagugccacuuuauuugccugucucuaaucuuuauccaccccccccccccccc
auuccgucauuggcaacaaaauugugaaguccucucggaccggugcccaccaacuccuuacguagaagaaucugcggauu
caagauucucacccucaaguagaucauuauauacgguuauccccucucucucucucucacucucuuuugauucuuaaaau
uccacaaacacacaccuccucgccuccuuccaaaauuugcuuuuuuguucccaucaucucauuaaucuugauuacuauuc
uuuuuugguuguacuuuuuauuuucauuuuugaaaaauauuuuuuccgucggaaaugaaaugaaauuuguuuauauuca


Updated miRanda Targets for lin-59 (Murari et al., submitted)

lin-59 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
88334 cel-miR-2212-3p lin-59 171 -23.57 92.86 100.00
68463 cel-miR-796 lin-59 169 -23.50 75.00 80.00
149312 cel-miR-8209-5p lin-59 159 -12.45 78.57 92.86
47229 cel-miR-254-5p lin-59 158 -11.05 75.00 75.00
58184 cel-lsy-6-3p lin-59 157 -6.77 72.22 83.33
69735 cel-miR-797-3p lin-59 155 -13.26 75.00 87.50
72490 cel-miR-1018 lin-59 155 -11.37 72.22 72.22
75194 cel-miR-1021 lin-59 154 -14.77 70.00 75.00
145311 cel-miR-8206-5p lin-59 153 -11.97 80.00 86.67
18904 cel-miR-73-5p lin-59 149 -16.33 72.73 72.73
59499 cel-miR-784-3p lin-59 147 -6.05 90.00 90.00
90340 cel-miR-1832b-3p lin-59 147 -20.03 70.59 76.47
1232 cel-miR-1-3p lin-59 146 -18.50 63.16 73.68
95247 cel-miR-2953-5p lin-59 146 -11.89 73.33 80.00
126511 cel-miR-5550-3p lin-59 145 -7.09 100.00 100.00
107204 cel-miR-4923a lin-59 145 -12.40 100.00 100.00
90877 cel-miR-2209b-3p lin-59 144 -11.82 81.82 81.82
3724 cel-miR-37-5p lin-59 143 -24.88 59.09 68.18
96220 cel-miR-4805-3p lin-59 143 -8.04 80.00 90.00
72491 cel-miR-1018 lin-59 143 -11.69 64.29 78.57
76298 cel-miR-1022-3p lin-59 142 -9.11 63.16 68.42
75195 cel-miR-1021 lin-59 142 -9.83 64.71 64.71
133318 cel-miR-356b-5p lin-59 141 -14.01 75.00 75.00
96221 cel-miR-4805-3p lin-59 140 -7.46 100.00 100.00



Predicted or Experimental Interactors for lin-59 (WormBase)

lin-59 has been predicted to interact with the following genes (data from WS200):

  • cdh-3 Lee I et al. (2008)
    cdh-3 encodes a member of the cadherin superfamily that affects morphogenesis of tail epithelia and excretory function; expressed predominantly in developing epithelial cells, and also expressed in the AC, excretory cell, various neurons, and vulval cells during different stages of development.
  • dnc-1 Lee I et al. (2008)
    DNC-1 encodes a dynactin, orthologous to Drosophila GLUED, that is required for pronuclear migration and centrosome separation in one-cell embryos and for the correct alignment of mitotic spindles in early embryos; DNC-1 shares embryonic functions with DNC-2, DHC-1, LIS-1 and NUD-1; DNC-1 is located at cortical microtubule attachment sites.
  • htz-1 Zhong W et al. (2006)
    htz-1 encodes the C. elegans ortholog of the H2A.Z histone variant; htz-1 is an essential gene and during development, HTZ-1 functions with the PHA-4/FoxA transcription factor and the MYS-1/TIP60-SSL-1/SWR1 remodeling complex to regulate gene expression during pharyngeal (foregut) organogenesis; a YFP::HTZ-1 fusion protein localizes to pharyngeal gene promoters at the onset of transcription, in a manner that requires PHA-4.
  • mab-5 Zhong W et al. (2006)
  • mab-9 Lee I et al. (2008)
    mab-9 encodes a member of the T-box family of transcriptional regulators containing a 200-amino acid T-box DNA-binding domain most similar to mouse Brachyury; mab-9 is involved in hindgut and male tail development, specifically affecting the fate of two posterior blast cells in the hindgut, B and F; in the male this results in a grossly abnormal tail lacking spicules, and renders them incapable of mating; in the hermaphrodite this results in hindgut defects; mab-9 may also be part of a network of T-box genes that includes tbx-8, tbx-9 and vab-7 and is important for the correct patterning of posterior cells in the developing embryo; mab-9 mutations also affect backward locomotion as a result of motor neuron axon guidance defects; MAB-9 localizes to the nucleus of B and F and their descendents during development and is also detected in the nuclei of all embryonically derived motor neurons.
  • mes-2 Zhong W et al. (2006)
    mes-2 encodes a SET domain-containing protein that is orthologous to the Drosophila Polycomb group protein Enhancer of zeste [E(Z)]; as a member of a Polycomb-like chromatin repressive complex with MES-3 and MES-6, MES-2 is required maternally for normal germline development and during larval development, for anteroposterior patterning; during germline development, the MES-2/MES-3/MES-6 complex is believed to be essential for maintaining repression of the X chromosome, and in transgenic animals, the complex is necessary for germline repression of repetitive transgenes; in axial patterning, the MES-2/MES-3/MES-6 complex is required in somatic tissues for maintaining homeotic gene repression, acting upstream of the Hox genes lin-39, mab-5, and egl-5, as well as the egl-5 target gene lin-32; in addition, MES-2 activity is required for normal levels and localization of MES-3 in >24-cell-stage embryos; MES-2 expression is detected in the primordial germ cells and germline nuclei throughout development, in all nuclei in early embryos, and in somatic nuclei, including those of the male tail, in L2 and L3 larvae; in the nucleus, MES-2 appears to localize to chromatin.
  • nos-3 Lee I et al. (2008)
    nos-3 encodes a homolog of Drosophila NANOS that physically interacts with FBF-1 (similar, though not orthologous, to Drosophila PUMILIO); NOS-3 is required in development of the hermaphrodite germ-line to promote the switch from sperm to oocyte production, perhaps by forming a complex with FBF-1 that controls fem-3 mRNA.
  • pat-3 Lee I et al. (2008)
    none available
  • ppk-1 Zhong W et al. (2006)
  • pqn-65 Lee I et al. (2008)


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001