T20F5.4

T20F5.4 |

No description available.

Graphics for T20F5.4

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for T20F5.4

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 20135 - Tier: 1 - Name: T20F5.4 - Cosmid: T20F5.4 - WBGeneID: WBGene00020626 - Length: 187 - PAS: gataaa
Cluster Coverage (%): 204 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
20135	T20F5.4	I	-	3912640	3912825	187nt	gataaa (-28nt)	204 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|187nt|I:3912640..3912825|PAS:gataaa
augaagcaccucauucucauuauuucaacaaaucucaucugcaaucuuaaacgcaaaauucuucaaaaucugaaauccac
gucauuguguaaacggacccauuugucuccuccauuuuucuuauuguauaaauguuuaaucucugaacuuauaucgauga
uaaaaucaauaaauauugaaauucca

Updated miRanda Targets for T20F5.4 (Murari et al., submitted)

T20F5.4 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
99619	cel-miR-4809-5p	T20F5.4	173	-20.52	83.33	94.44
59081	cel-miR-392-3p	T20F5.4	151	-14.44	75.00	81.25
97531	cel-miR-4805-3p	T20F5.4	149	-5.61	83.33	83.33
146915	cel-miR-8206-3p	T20F5.4	145	-9.92	100.00	100.00
85672	cel-miR-2208b-3p	T20F5.4	142	-10.13	63.64	63.64
49026	cel-miR-255-5p	T20F5.4	140	-7.05	100.00	100.00
104260	cel-miR-4813-3p	T20F5.4	140	-12.53	100.00	100.00