T20F5.4
T20F5.4 |
No description available.
Graphics for T20F5.4
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for T20F5.4
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 20135 -
Tier: 1 -
Name: T20F5.4 -
Cosmid: T20F5.4 -
WBGeneID: WBGene00020626 -
Length: 187 -
PAS: gataaa
Cluster Coverage (%): 204 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
20135 | T20F5.4 | I | - | 3912640 | 3912825 | 187nt | gataaa (-28nt) | 204 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|187nt|I:3912640..3912825|PAS:gataaa
augaagcaccucauucucauuauuucaacaaaucucaucugcaaucuuaaacgcaaaauucuucaaaaucugaaauccac gucauuguguaaacggacccauuugucuccuccauuuuucuuauuguauaaauguuuaaucucugaacuuauaucgauga uaaaaucaauaaauauugaaauucca
Updated miRanda Targets for T20F5.4 (Murari et al., submitted)
T20F5.4 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
99619 | cel-miR-4809-5p | T20F5.4 | 173 | -20.52 | 83.33 | 94.44 | 59081 | cel-miR-392-3p | T20F5.4 | 151 | -14.44 | 75.00 | 81.25 | 97531 | cel-miR-4805-3p | T20F5.4 | 149 | -5.61 | 83.33 | 83.33 | 146915 | cel-miR-8206-3p | T20F5.4 | 145 | -9.92 | 100.00 | 100.00 | 85672 | cel-miR-2208b-3p | T20F5.4 | 142 | -10.13 | 63.64 | 63.64 | 49026 | cel-miR-255-5p | T20F5.4 | 140 | -7.05 | 100.00 | 100.00 | 104260 | cel-miR-4813-3p | T20F5.4 | 140 | -12.53 | 100.00 | 100.00 |
More on T20F5.4
Related Papers
There are no recent papers related to T20F5.4.The APAome Project is currently funded by the School of Life Sciences at Arizona State University