T20F5.6

T20F5.6 |

No description available.

Graphics for T20F5.6

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1136 (I:3927889..3920179)
CEOP1136 contains 3 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for T20F5.6

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 20139 - Tier: 1 - Name: T20F5.6 - Cosmid: T20F5.6 - WBGeneID: WBGene00020628 - Length: 223 - PAS: tctaaa
Cluster Coverage (%): 640 reads (32.80%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
20139	T20F5.6	I	-	3920349	3920570	223nt	tctaaa (-25nt)	640 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|223nt|I:3920349..3920570|PAS:tctaaa
acuggucuuauuaauuauucuuuuucaagucaaucuuaaauauuuuauuuauguuuuuucuucuguaacuccccccuccc
aauuccugucaucauuaucauuaucaccagugggauuguacccuuuuucuauucucgugaucguaucucauguucauucc
gacuacagcuuuuauauuuccaauacuauuugugaauucuaaauaguuuaauuuguucucuu

2 ID: 20138 - Tier: 1 - Name: T20F5.6 - Cosmid: T20F5.6 - WBGeneID: WBGene00020628 - Length: 374 - PAS: tcttta
Cluster Coverage (%): 1309 reads (67.20%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
20138	T20F5.6	I	-	3920198	3920570	374nt	tcttta (-14nt)	1309 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|374nt|I:3920198..3920570|PAS:tcttta
acuggucuuauuaauuauucuuuuucaagucaaucuuaaauauuuuauuuauguuuuuucuucuguaacuccccccuccc
aauuccugucaucauuaucauuaucaccagugggauuguacccuuuuucuauucucgugaucguaucucauguucauucc
gacuacagcuuuuauauuuccaauacuauuugugaauucuaaauaguuuaauuuguucucuucuguauccgcuuaucauc
aauucaauuuuauuuagaaauaauuucaaugaguguuuaaaaaacgcgugaacccuuuaaaaaagaaucucccacuaguu
ccacagaucguggaaauaaucaguucucaauaagaaguuucuuuauuuuguca

Updated miRanda Targets for T20F5.6 (Murari et al., submitted)

T20F5.6 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
148715	cel-miR-8207-3p	T20F5.6	155	-13.88	75.00	87.50
47622	cel-miR-254-5p	T20F5.6	153	-14.42	68.75	81.25
77737	cel-miR-1819-3p	T20F5.6	153	-20.58	71.43	76.19
88684	cel-miR-2213-3p	T20F5.6	153	-16.22	75.00	75.00
47623	cel-miR-254-5p	T20F5.6	151	-15.17	70.59	82.35
65017	cel-miR-789-2-5p	T20F5.6	151	-17.27	72.22	83.33
95640	cel-miR-2953-5p	T20F5.6	146	-13.86	65.00	70.00
64410	cel-miR-789-5p	T20F5.6	145	-13.75	100.00	100.00
94086	cel-miR-2220-5p	T20F5.6	145	-10.95	100.00	100.00
95641	cel-miR-2953-5p	T20F5.6	141	-15.62	57.89	73.68
57776	cel-miR-359	T20F5.6	140	-12.93	100.00	100.00