T20F5.7

T20F5.7 |

No description available.

Graphics for T20F5.7

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1136 (I:3927889..3920179)
CEOP1136 contains 3 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for T20F5.7

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 20141 - Tier: 1 - Name: T20F5.7 - Cosmid: T20F5.7 - WBGeneID: WBGene00020629 - Length: 403 - PAS: tataaa
Cluster Coverage (%): 2328 reads (77.10%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
20141	T20F5.7	I	-	3925436	3925837	403nt	tataaa (-18nt)	2328 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|403nt|I:3925436..3925837|PAS:tataaa
aauaaccuucucgaagagaugacuagaaaauaaauauucgggcuuuucauaauucucauccgcuauuaguucucaaaauu
agaaguuuuaaccucauacaaaaugaucugcaugaaaauauuucacauuuuauauuaaguuucuuuucuccuccacacau
ucuuggucucucccaccuccuccccguccccccucagcucuuucuuuuauccugauuaauuugaauguuuuuuugauucc
acguguucucuuccguaucauuuuucuauuuuuauuuauuacuguuccauuccccaaauguuuuuuucucguuucguuuc
guuuucgugcucuuuuauuuauugcucgaauauucgaaucggauagucuuugagaacccaauuuuauaaaugcauucauu
ua

2 ID: 20140 - Tier: 1 - Name: T20F5.7 - Cosmid: T20F5.7 - WBGeneID: WBGene00020629 - Length: 413 - PAS: tataaa
Cluster Coverage (%): 693 reads (22.90%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
20140	T20F5.7	I	-	3925426	3925837	413nt	tataaa (-28nt)	693 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

>|3'UTR|413nt|I:3925426..3925837|PAS:tataaa
aauaaccuucucgaagagaugacuagaaaauaaauauucgggcuuuucauaauucucauccgcuauuaguucucaaaauu
agaaguuuuaaccucauacaaaaugaucugcaugaaaauauuucacauuuuauauuaaguuucuuuucuccuccacacau
ucuuggucucucccaccuccuccccguccccccucagcucuuucuuuuauccugauuaauuugaauguuuuuuugauucc
acguguucucuuccguaucauuuuucuauuuuuauuuauuacuguuccauuccccaaauguuuuuuucucguuucguuuc
guuuucgugcucuuuuauuuauugcucgaauauucgaaucggauagucuuugagaacccaauuuuauaaaugcauucauu
uaccuuuuuuua

Updated miRanda Targets for T20F5.7 (Murari et al., submitted)

T20F5.7 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
150365	cel-miR-8209-5p	T20F5.7	167	-17.87	72.22	88.89
98311	cel-miR-4805-3p	T20F5.7	158	-10.54	84.62	92.31
76259	cel-miR-1022-5p	T20F5.7	157	-12.66	77.78	77.78
58805	cel-lsy-6-3p	T20F5.7	155	-15.58	100.00	100.00
85753	cel-miR-2208b-3p	T20F5.7	154	-12.61	81.25	81.25
130122	cel-miR-5551-5p	T20F5.7	152	-9.31	73.33	80.00
138673	cel-miR-8192-3p	T20F5.7	152	-14.84	76.47	76.47
103728	cel-miR-4813-5p	T20F5.7	151	-15.67	65.22	73.91
144559	cel-miR-4810b-3p	T20F5.7	148	-9.47	81.82	90.91
105297	cel-miR-4815	T20F5.7	145	-11.52	73.33	80.00
129582	cel-miR-5550-3p	T20F5.7	145	-7.63	75.00	83.33
67992	cel-miR-794-3p	T20F5.7	140	-12.98	100.00	100.00