egg-4

3'UTR mapped for egg-4

1 ID: 20164 - Tier: 1 - Name: egg-4 - Cosmid: T21E3.1 - WBGeneID: WBGene00020652 - Length: 100 - PAS: tataaa
Cluster Coverage (%): 2445 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|100nt|I:3934715..3934814|PAS:tataaa
uuaucauguauacuaaaccuccacucacuauuauuauuuuuauuuagaacauucugugaaauauugcaugauacuguaua
aaaugcauuuuaacuguca

Updated miRanda Targets for egg-4 (Murari et al., submitted)

Predicted or Experimental Interactors for egg-4 (WormBase)

• car-1 Lee I et al. (2008)
  
• chs-1 Lee I et al. (2008)
  chs-1 encodes a chitin synthase, paralogous to CHS-2; chs-1 is required for embryonic chitin synthesis, eggshell synthesis and osmotic integrity, error-free chromosomal segregation during meiosis, polar body extrusion, association of the sperm pronucleus/centrosome complex (SPCC) with the early embryonic cortex, localization of PAR-2 in early embryos, posterior localization of P granules or PIE-1, and pseudocleavage; CHS-1 is also, independently of chitin synthesis, required for normal localization of MBK-2 to cortex and punctae in early embryos; CHS-1 is dispensable for synthesis of pharyngeal cuticle, since chs-1(ok1120) mutants have it normally; CHS-1 is predicted to be in the plasma membrane rather than the Golgi apparatus.
• cyb-2.1 Lee I et al. (2008)
  none available
• fbxa-215 Lee I et al. (2008)
  
• gld-1 Lee I et al. (2008)
  gld-1 encodes a protein containing a K homology RNA binding domain that is required for meiotic cell cycle progression during oogenesis in parallel with gld-2, and also affects spermatogenesis; it physically interacts with its putative mRNA targets in vitro and with FOG-2, and is expressed in the cytoplasm at high levels during meiotic prophase.
• glh-1 Lee I et al. (2008)
  glh-1 encodes a putative DEAD-box RNA helicase that contains four CCHC zinc fingers and is homologous to Drosophila VASA, a germ-line-specific, ATP-dependent RNA helicase; at permissive temperature, GLH-1 is required redundantly with GLH-4 for proper germ-line development and fertility, specifically for regulating the normal extent of germ-line proliferation, oogenesis, and the production of functional sperm; GLH-1 activity is also likely required for the wild-type morphology of P granules and for localization of several protein components, such as PGL-1, but not for accumulation of P granule mRNAs; GLH-1 interacts in vivo with CSN-5, a COP9 signalosome component, and in vitro with itself and with KGB-1, a JNK-like MAP kinase, ZYX-1, a LIM domain-containing zyxin homologue, and GLH-3; GLH-1 is a constitutive P granule component and thus, with the exception of mature sperm, is expressed in germ cells at all stages of development; consistent with its P granule localization, GLH-1 is cytoplasmic in oocytes and the early embryo, while perinuclear in all later developmental stages as well as in the distal and medial regions of the hermaphrodite gonad; GLH-1 is also expressed in males.
• gna-2 Lee I et al. (2008)
  
• him-3 Lee I et al. (2008)
  him-3 encodes a homolog of the S. cerevisiae HOP1 protein which is required for the formation of the synaptonemal complex during meiosis; him-3 is required for synapsis and chiasma formation during meiotic recombination and for chromosome segregation; him-3 mutants show a high frequency of males in the population as well as a high frequency of arrested embryos due to defects in X-chromosome segregation; HIM-3 localizes to the meiotic chromosome associating with both unsynapsed and synapsed chromosomes.
• hke-4.1 Lee I et al. (2008)
  none available
• hmg-12 Lee I et al. (2008)
  none available

Links

External Databases