UTRome

lrp-2

T21E3.3 | Low-density lipoprotein RecePtor related 2

No description available.

Graphics for lrp-2

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for lrp-2

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 2377 - Tier: 1 - Name: lrp-2 - Cosmid: T21E3.3 - WBGeneID: WBGene00003072 - Length: 224 - PAS: agtaaa
Cluster Coverage (%): 1481 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
2377 lrp-2 I - 3935272 3935494 224nt agtaaa (-19nt) 1481 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|224nt|I:3935272..3935494|PAS:agtaaa
cuuucugaaacucaauuccuauauuuucacuugccacagcuuucuucucuauuuauauuccuuauucccuuaacaaacug
auaaaaaaaaacucauuuucaauaucauuuucucuugucgacaggguccuuguuuuguuguaacuauuuucuauuucuug
uccucgacgauucuguucuguuucuuuuuaagcugguauaaccaauuaaguuuugaauucuua


Updated miRanda Targets for lrp-2 (Murari et al., submitted)

lrp-2 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
12560 cel-miR-57-5p lrp-2 154 -18.11 80.00 86.67
142840 cel-miR-8202-5p lrp-2 152 -17.29 76.47 76.47
41353 cel-miR-247-5p lrp-2 145 -8.46 100.00 100.00
88771 cel-miR-2215-3p lrp-2 144 -12.47 81.82 81.82
106014 cel-miR-4920 lrp-2 142 -8.13 88.89 88.89
29026 cel-miR-86-5p lrp-2 140 -7.70 100.00 100.00
60685 cel-miR-785-3p lrp-2 140 -11.74 100.00 100.00



Predicted or Experimental Interactors for lrp-2 (WormBase)

lrp-2 has been predicted to interact with the following genes (data from WS200):

  • ttm-1 Zhong W et al. (2006)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001