lrp-2
T21E3.3 | Low-density lipoprotein RecePtor related 2
No description available.
Graphics for lrp-2
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for lrp-2
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 2377 -
Tier: 1 -
Name: lrp-2 -
Cosmid: T21E3.3 -
WBGeneID: WBGene00003072 -
Length: 224 -
PAS: agtaaa
Cluster Coverage (%): 1481 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
2377 | lrp-2 | I | - | 3935272 | 3935494 | 224nt | agtaaa (-19nt) | 1481 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|224nt|I:3935272..3935494|PAS:agtaaa
cuuucugaaacucaauuccuauauuuucacuugccacagcuuucuucucuauuuauauuccuuauucccuuaacaaacug auaaaaaaaaacucauuuucaauaucauuuucucuugucgacaggguccuuguuuuguuguaacuauuuucuauuucuug uccucgacgauucuguucuguuucuuuuuaagcugguauaaccaauuaaguuuugaauucuua
Updated miRanda Targets for lrp-2 (Murari et al., submitted)
lrp-2 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
12560 | cel-miR-57-5p | lrp-2 | 154 | -18.11 | 80.00 | 86.67 | 142840 | cel-miR-8202-5p | lrp-2 | 152 | -17.29 | 76.47 | 76.47 | 41353 | cel-miR-247-5p | lrp-2 | 145 | -8.46 | 100.00 | 100.00 | 88771 | cel-miR-2215-3p | lrp-2 | 144 | -12.47 | 81.82 | 81.82 | 106014 | cel-miR-4920 | lrp-2 | 142 | -8.13 | 88.89 | 88.89 | 29026 | cel-miR-86-5p | lrp-2 | 140 | -7.70 | 100.00 | 100.00 | 60685 | cel-miR-785-3p | lrp-2 | 140 | -11.74 | 100.00 | 100.00 |
Predicted or Experimental Interactors for lrp-2 (WormBase)
lrp-2 has been predicted to interact with the following genes (data from WS200):- ttm-1 Zhong W et al. (2006)
none available
More on lrp-2
Related Papers
Related lrp Genes
![SoLS](/UTRome/images/SOLS_RGB.png)
The APAome Project is currently funded by the School of Life Sciences at Arizona State University