UTRome

cah-6

T28F2.3 | Carbonic AnHydrase 6

cah-6 encodes a predicted carbonic anhydrase.

Graphics for cah-6

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for cah-6

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 316 - Tier: 1 - Name: cah-6 - Cosmid: T28F2.3 - WBGeneID: WBGene00000284 - Length: 347 - PAS: AATAAA
Cluster Coverage (%): 2405 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
316 cah-6 I + 3630730 3631076 347nt AATAAA (-18nt) 2405 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|347nt|I:3630730..3631076|PAS:AATAAA
uaugguaccucaaccaccgccaaccggcugugauacucgucuucucguucagucaugcuuuccguauacuauuuuuaaga
cauaacccauuccggaacuuuaaaggcacaugcuucagcaagaucuacauuuagauagagcgucauuaugugccuuuaaa
gccccauuuuucagauuugcaauacaauaauccaaaaacgcaauaacuucccccagcauucacauauuuuugauucacuu
uucacacacacuuuucucuccaaaaggucucacauaugccaagcgucuugaucucuuuuugaaaaaaaauguuuagaugu
auaguuguaauaaauauuugguuaga


Updated miRanda Targets for cah-6 (Murari et al., submitted)

cah-6 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
2305 cel-miR-2-3p cah-6 159 -20.98 75.00 75.00
41065 cel-miR-247-5p cah-6 159 -12.10 85.71 85.71
31534 cel-miR-124-3p cah-6 157 -21.53 66.67 88.89
101880 cel-miR-4810a cah-6 154 -18.18 70.59 76.47
6119 cel-miR-43-3p cah-6 152 -14.67 63.16 73.68
60546 cel-miR-785-3p cah-6 151 -13.21 63.64 72.73
44878 cel-miR-250-3p cah-6 150 -20.71 64.71 76.47
83310 cel-miR-58b-3p cah-6 150 -13.69 70.00 70.00
152735 cel-miR-58c cah-6 149 -17.12 66.67 77.78
106991 cel-miR-4923a cah-6 147 -12.61 61.11 72.22
28887 cel-miR-86-5p cah-6 145 -8.57 100.00 100.00
47657 cel-miR-254-3p cah-6 145 -11.10 100.00 100.00
68980 cel-miR-797-5p cah-6 145 -14.63 100.00 100.00
86095 cel-miR-2209a-3p cah-6 145 -15.26 73.33 80.00
24610 cel-miR-82-3p cah-6 144 -13.59 57.89 68.42
23419 cel-miR-81-3p cah-6 141 -13.50 66.67 83.33
22229 cel-miR-80-3p cah-6 141 -11.55 71.43 78.57



Predicted or Experimental Interactors for cah-6 (WormBase)

cah-6 has been predicted to interact with the following genes (data from WS200):

  • gbh-2 Zhong W et al. (2006)
    gbh-2 encodes an ortholog of human gamma butyrobetaine hydroxilase 2 involved in carnitine biosynthesis; RNA interference of gbh-2 results in malformation of the gonad and accumulation of fat in the pseudocoelomic cavity and in intestinal cells; the GBH-2-GFP fusion protein is predominantly expressed in intestinal cells from early embryogenesis.


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001