cah-6
T28F2.3 | Carbonic AnHydrase 6
cah-6 encodes a predicted carbonic anhydrase.
Graphics for cah-6
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for cah-6
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 316 -
Tier: 1 -
Name: cah-6 -
Cosmid: T28F2.3 -
WBGeneID: WBGene00000284 -
Length: 347 -
PAS: AATAAA
Cluster Coverage (%): 2405 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
316 | cah-6 | I | + | 3630730 | 3631076 | 347nt | AATAAA (-18nt) | 2405 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|347nt|I:3630730..3631076|PAS:AATAAA
uaugguaccucaaccaccgccaaccggcugugauacucgucuucucguucagucaugcuuuccguauacuauuuuuaaga cauaacccauuccggaacuuuaaaggcacaugcuucagcaagaucuacauuuagauagagcgucauuaugugccuuuaaa gccccauuuuucagauuugcaauacaauaauccaaaaacgcaauaacuucccccagcauucacauauuuuugauucacuu uucacacacacuuuucucuccaaaaggucucacauaugccaagcgucuugaucucuuuuugaaaaaaaauguuuagaugu auaguuguaauaaauauuugguuaga
Updated miRanda Targets for cah-6 (Murari et al., submitted)
cah-6 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
2305 | cel-miR-2-3p | cah-6 | 159 | -20.98 | 75.00 | 75.00 | 41065 | cel-miR-247-5p | cah-6 | 159 | -12.10 | 85.71 | 85.71 | 31534 | cel-miR-124-3p | cah-6 | 157 | -21.53 | 66.67 | 88.89 | 101880 | cel-miR-4810a | cah-6 | 154 | -18.18 | 70.59 | 76.47 | 6119 | cel-miR-43-3p | cah-6 | 152 | -14.67 | 63.16 | 73.68 | 60546 | cel-miR-785-3p | cah-6 | 151 | -13.21 | 63.64 | 72.73 | 44878 | cel-miR-250-3p | cah-6 | 150 | -20.71 | 64.71 | 76.47 | 83310 | cel-miR-58b-3p | cah-6 | 150 | -13.69 | 70.00 | 70.00 | 152735 | cel-miR-58c | cah-6 | 149 | -17.12 | 66.67 | 77.78 | 106991 | cel-miR-4923a | cah-6 | 147 | -12.61 | 61.11 | 72.22 | 28887 | cel-miR-86-5p | cah-6 | 145 | -8.57 | 100.00 | 100.00 | 47657 | cel-miR-254-3p | cah-6 | 145 | -11.10 | 100.00 | 100.00 | 68980 | cel-miR-797-5p | cah-6 | 145 | -14.63 | 100.00 | 100.00 | 86095 | cel-miR-2209a-3p | cah-6 | 145 | -15.26 | 73.33 | 80.00 | 24610 | cel-miR-82-3p | cah-6 | 144 | -13.59 | 57.89 | 68.42 | 23419 | cel-miR-81-3p | cah-6 | 141 | -13.50 | 66.67 | 83.33 | 22229 | cel-miR-80-3p | cah-6 | 141 | -11.55 | 71.43 | 78.57 |
Predicted or Experimental Interactors for cah-6 (WormBase)
cah-6 has been predicted to interact with the following genes (data from WS200):- gbh-2 Zhong W et al. (2006)
gbh-2 encodes an ortholog of human gamma butyrobetaine hydroxilase 2 involved in carnitine biosynthesis; RNA interference of gbh-2 results in malformation of the gonad and accumulation of fat in the pseudocoelomic cavity and in intestinal cells; the GBH-2-GFP fusion protein is predominantly expressed in intestinal cells from early embryogenesis.
More on cah-6
Related Papers
Related cah Genes

The APAome Project is currently funded by the School of Life Sciences at Arizona State University