col-50

T28F2.6 | COLlagen 50

col-50 encodes a cuticle collagen.

Graphics for col-50

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for col-50

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 596 - Tier: 1 - Name: col-50 - Cosmid: T28F2.6 - WBGeneID: WBGene00000627 - Length: 68 - PAS: aataaa
Cluster Coverage (%): 3101 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
596	col-50	I	-	3651230	3651296	68nt	aataaa (-21nt)	3101 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|68nt|I:3651230..3651296|PAS:aataaa
agaggucccgacuauuauuugauugucccucuuuauauauauagaaaauaaauaauuuucuucccca

Predicted or Experimental Interactors for col-50 (WormBase)

col-50 has been predicted to interact with the following genes (data from WS200):

lsm-6 Lee I et al. (2008)
none available
lsm-7 Lee I et al. (2008)
none available
xrn-1 Lee I et al. (2008)

Links

Direct link to this page

External Databases

More on col-50

» Browse with GBrowse

Related Papers

There are no recent papers related to col-50.

Related col Genes

col-2 col-2 encodes a member of the collagen superfamily containing collagen triple he...(more)

col-3 col-3 encodes a collagen protein that affects body morphogenesis, larval viabili...(more)

col-5 col-5 is a predicted collagen gene that was first identified as an MspI polymorp...(more)

col-7 col-7 encodes a member of the collagen superfamily containing collagen triple he...(more)

col-8 col-8 encodes a collagen, individually dispensable for viability and gross morph...(more)

col-9 col-9 encodes a collagen protein....(more)

col-10 col-10 encodes a collagen protein; expressed exclusively in hypodermal cells...(more)

col-11 none available...(more)

col-12 col-12 encodes a member of the collagen superfamily containing collagen triple h...(more)

col-13 col-13 encodes a collagen which is expressed in all stages of development, like ...(more)

The APAome Project is currently funded by the School of Life Sciences at Arizona State University