col-51
T28F2.8 | COLlagen 51
col-51 encodes a cuticle collagen.
Graphics for col-51
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for col-51
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 597 -
Tier: 1 -
Name: col-51 -
Cosmid: T28F2.8 -
WBGeneID: WBGene00000628 -
Length: 62 -
PAS: AATAAA
Cluster Coverage (%): 2237 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
597 | col-51 | I | + | 3655265 | 3655326 | 62nt | AATAAA (-18nt) | 2237 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|62nt|I:3655265..3655326|PAS:AATAAA
ucccauuuguguuaugacgaaaguuauaagaaaaucauaugaaaauaaacgauucauuaga
Updated miRanda Targets for col-51 (Murari et al., submitted)
col-51 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
88756 | cel-miR-2215-3p | col-51 | 140 | -11.36 | 100.00 | 100.00 | 103117 | cel-miR-4811-3p | col-51 | 140 | -9.31 | 100.00 | 100.00 |
Predicted or Experimental Interactors for col-51 (WormBase)
col-51 has been predicted to interact with the following genes (data from WS200):- col-120 Lee I et al. (2008)
none available - col-2 Lee I et al. (2008)
col-2 encodes a member of the collagen superfamily containing collagen triple helix repeats (20 copies); expression peaks during the molt that separates the L2 larval and dauer stages as the dauer cuticle is being formed, and mRNA is expressed at low levels in post-dauer L4 larvae and in adult animals. - col-37 Lee I et al. (2008)
col-37 encodes a cuticle collagen. - col-43 Lee I et al. (2008)
col-43 encodes a collagen that is individually dispensable for viability and gross morphology in mass RNAi screens. - col-63 Lee I et al. (2008)
none available - col-88 Lee I et al. (2008)
none available - col-93 Lee I et al. (2008)
none available - col-97 Lee I et al. (2008)
col-97 encodes a cuticular collagen; loss of col-97 activity via large-scale RNAi screens results in defects in body morphology and locomotion. - lsm-6 Lee I et al. (2008)
none available - lsm-7 Lee I et al. (2008)
none available
More on col-51
Related Papers
There are no recent papers related to col-51.Related col Genes
![SoLS](/UTRome/images/SOLS_RGB.png)
The APAome Project is currently funded by the School of Life Sciences at Arizona State University