UTRome

col-51

T28F2.8 | COLlagen 51

col-51 encodes a cuticle collagen.

Graphics for col-51

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for col-51

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 597 - Tier: 1 - Name: col-51 - Cosmid: T28F2.8 - WBGeneID: WBGene00000628 - Length: 62 - PAS: AATAAA
Cluster Coverage (%): 2237 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
597 col-51 I + 3655265 3655326 62nt AATAAA (-18nt) 2237 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|62nt|I:3655265..3655326|PAS:AATAAA
ucccauuuguguuaugacgaaaguuauaagaaaaucauaugaaaauaaacgauucauuaga


Updated miRanda Targets for col-51 (Murari et al., submitted)

col-51 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
88756 cel-miR-2215-3p col-51 140 -11.36 100.00 100.00
103117 cel-miR-4811-3p col-51 140 -9.31 100.00 100.00



Predicted or Experimental Interactors for col-51 (WormBase)

col-51 has been predicted to interact with the following genes (data from WS200):

  • col-120 Lee I et al. (2008)
    none available
  • col-2 Lee I et al. (2008)
    col-2 encodes a member of the collagen superfamily containing collagen triple helix repeats (20 copies); expression peaks during the molt that separates the L2 larval and dauer stages as the dauer cuticle is being formed, and mRNA is expressed at low levels in post-dauer L4 larvae and in adult animals.
  • col-37 Lee I et al. (2008)
    col-37 encodes a cuticle collagen.
  • col-43 Lee I et al. (2008)
    col-43 encodes a collagen that is individually dispensable for viability and gross morphology in mass RNAi screens.
  • col-63 Lee I et al. (2008)
    none available
  • col-88 Lee I et al. (2008)
    none available
  • col-93 Lee I et al. (2008)
    none available
  • col-97 Lee I et al. (2008)
    col-97 encodes a cuticular collagen; loss of col-97 activity via large-scale RNAi screens results in defects in body morphology and locomotion.
  • lsm-6 Lee I et al. (2008)
    none available
  • lsm-7 Lee I et al. (2008)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001