Y47G6A.25

Y47G6A.25 |

Y47G6A.25 encodes a novel protein conserved in C. remanei and C. briggsae.

Graphics for Y47G6A.25

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

Operon Information

This gene is part of the operon CEOP1100 (I:3608347..3604521)
CEOP1100 contains 3 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for Y47G6A.25

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 21250 - Tier: 1 - Name: Y47G6A.25 - Cosmid: Y47G6A.25 - WBGeneID: WBGene00021649 - Length: 57 - PAS: AATAAA
Cluster Coverage (%): 645 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
21250	Y47G6A.25	I	-	3606411	3606466	57nt	AATAAA (-20nt)	645 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|57nt|I:3606411..3606466|PAS:AATAAA
uuuauuuuuugagauuuuuagaggaucgaauuuuagaauaaagcacuuggaauuua

Updated miRanda Targets for Y47G6A.25 (Murari et al., submitted)

Y47G6A.25 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
140039	cel-miR-8197-5p	Y47G6A.25	150	-13.14	76.92	84.62
74851	cel-miR-1020-3p	Y47G6A.25	147	-7.38	61.11	72.22
51165	cel-miR-259-5p	Y47G6A.25	140	-8.65	100.00	100.00