Y47G6A.3
Y47G6A.3 |
No description available.
Graphics for Y47G6A.3
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for Y47G6A.3
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 21230 -
Tier: 1 -
Name: Y47G6A.3 -
Cosmid: Y47G6A.3 -
WBGeneID: WBGene00021633 -
Length: 50 -
PAS: AATAAA
Cluster Coverage (%): 623 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
| id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
|---|---|---|---|---|---|---|---|---|
| 21230 | Y47G6A.3 | I | + | 3602858 | 3602907 | 50nt | AATAAA (-19nt) | 623 reads |
This 3'UTR isoform has been detected in the following tissues:
| UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
|---|---|---|---|---|---|---|---|---|
 |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|50nt|I:3602858..3602907|PAS:AATAAA
ggaaauguacuaugcuuuacacuugucggaaauaaauuuugguucuuua
Updated miRanda Targets for Y47G6A.3 (Murari et al., submitted)
Y47G6A.3 transcript has been predicted to be targeted by the following miRNAs:| ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
|---|---|---|---|---|---|---|
| 87103 | cel-miR-2209c-5p | Y47G6A.3 | 143 | -9.94 | 83.33 | 83.33 | 85988 | cel-miR-2209a-5p | Y47G6A.3 | 140 | -7.73 | 100.00 | 100.00 |
External Databases
More on Y47G6A.3
Related Papers
There are no recent papers related to Y47G6A.3.Related y47g6a.3 Genes
The APAome Project is currently funded by the School of Life Sciences at Arizona State University